Расшифровка сч 15: Чугун СЧ15 — расшифровка, химический состав, применение

Содержание

Расшифровка обозначений марок сталей и чугунов.

     Чугун  –  сплав  железа  с  углеродом,  содержащий  более  2,14% углерода, постоянные примеси. Они мало  пластичны, не прокатываются  и не  куются. Чугуны  обладают пониженной температурой плавления и хорошими литейными свойствами. За  счет  этого  из  чугунов  можно  делать  отливки  значительно  более  сложной  формы, чем из сталей. 

Разновидности чугунов:

   В  зависимости  от  того,  какой  формы  присутствует  углерод  в  сплавах различают белые, серые, ковкие и высокопрочные чугуны. 

  • Белый чугунТакое название он получил по виду излома, который имеет матово-белый цвет. Весь углерод в этом чугуне находится в связанном состоянии в виде  цементит. Белые чугуны имеют большую твердость (НВ 450-550) и , как  следствие этого, они очень хрупкие и для изготовления деталей машин не  используются.  

         Высокая твердость белого чугуна обеспечивает его износостойкость, в том числе и при воздействии агрессивных сред.

Это                         свойство  учитывают при изготовлении из него поршневых колец. Однако белый чугун применяют  главным образом для отливки                 деталей на ковкий чугун, поэтому его  называют передельным.

  • Серый чугун В сером чугуне углерод находится в виде графита пластинчатой формы. Серые чугуны маркируются сочетанием букв «С»  –  серый, «Ч»-  чугун  и  цифрами, которые обозначают   временное сопротивление разрыву при растяжении в Мпа.
  • Высокопрочный чугунОтличительной особенностью      высокопрочного чугуна являются его высокие   механические   свойства, так как структура углерода в нем – шаровидный графит.  Это повышает прочность чугуна и позволяет получить сплавы с достаточно высокой пластичностью и вязкостью.

  Обозначение марки включает буквы «В» – высокопрочный, «Ч» – чугун и цифры, обозначающие временное сопротивление разрыву при растяжении в Мпа.

  • Ковкий чугунКовкими называют чугуны, в которых графит имеет хлопьевидную форму. Несмотря на свое название, они никогда не подвергаются ковке. Конфигурация детали из ковкого чугуна определяется формой отливки. Ковкие  чугуны  маркируют  «К»  –  ковкий,  «Ч»  –  чугун  и  цифрами. 

Первая группа цифр – показывает  предел прочности чугуна  при  растяжении,  МПа: 

Вторые – относительное удлинение при разрыве в %.

Чугуны со специальными свойствами.

В зависимости от назначения различают износостойкие, антифрикционные, жаростойкие и коррозионностойкие чугуны.

Износостойкие (антифрикционные ) чугуны. 

Обозначают сочетанием букв АЧС, АЧК, АЧВ. Буквы С, К, В обозначают вид чугуна: серый, ковкий, высокопрочный. Цифра обозначает номер чугуна.

Для легирования антифрикционных чугунов применяют хром, никель, медь, титан.

Жаростойкие и жаропрочные чугуны.

Обозначают набором заглавных букв русского алфавита и следующими за ними букв. Буква «Ч» – чугун. Буква «Ш», стоящая в конце марки означает шаровидную форму графита. Остальные буквы означают легирующие элементы, а числа, следующие за ними, соответствуют их процентному содержанию в чугуне.

Жаростойкие чугуны применяют для изготовления деталей контактных аппаратов химического оборудования, работающих в газовых средах при 0 температуре 900-1100 С.

Коррозионностойкие чугуны.

Коррозионностойкие чугуны, обладают высокой стойкостью в газовой, воздушной и щелочных средах. Их применяют для изготовления деталей узлов трения, работающих при повышенных температурах.

Примеры обозначения и расшифровки:

1.  СЧ15   –   серый   чугун, временное сопротивление при  растяжении 150Мпа.

2.  КЧ45-7  –   ковкий  чугун,  временное  сопротивление  при растяжении 450Мпа, относительное удлинение 7%.

3.  ВЧ70      –   высокопрочный чугун, временное сопротивление при растяжении 700 МПА

4.  АЧВ – 2 – антифрикционный высокопрочный чугун, номер 2.

5.  ЧН20Д2ХШ –  жаропрочный  высоколегированный чугун, содержащий никеля 20%, 2% меди, 1% хрома, остальное –  железо, углерод, форма графита – шаровидная

6.  ЧС17  –   коррозионностойкий  кремниевый  чугун,  содержащий  17% кремния, остальное –железо, углерод.

Определение :

Сталь –  сплав железа с углеродом, содержащий углерода не более 2,14%, а также ряд других элементов.

Классификация: 

Для правильного прочтения марки необходимо учитывать ее место в

классификации стали по химическому составу, назначению, качеству, степени раскисления.

По химическому составу стали подразделяют на углеродистые и легированные.

Стали по назначению делят на конструкционные, инструментальные и стали специального назначения с особыми свойствами.

Стали по качеству классифицируют на стали обыкновенного качества, качественные, высококачественные и особо                             высококачественные.

Классификация по степени раскисления. Стали по степени раскисления классифицируют на спокойные, полуспокойные и кипящие .

Таблица 1. – Классификация сталей

Стали по химическому составу
Углеродистые Легированные
низкоуглеродистые (до 0,25% С),

 

среднеуглеродистые (0,25-0,6% С

высокоуглеродистые (более  0,6% С)

низколегированную (с суммарным содержанием легирующих элементов до 2,5%),

среднелегированную (от 2,5до 10%)

и высоколегированную (свыше 10%).

По назначению
инструментальные конструкционные
По качеству (содержанию вредных примесей) 
Обыкновенного качества содержат до 0,06% S и

0,07% Р

 

Качественные до 0,035% S и 0,035% Р Высококачествен-

ные  не более 0,025% S и 0,025% Р

Особо высококачествен-

ные  не  более  0,015%  S и 0,025% Р

 

Конструкционные стали – стали, предназначенные для изготовления различных деталей, узлов механизмов и конструкций.

    Инструментальные стали – стали, применяемые для обработки материалов резанием или давлением, а также для изготовления измерительного инструмента.

Специальные стали — это высоколегированные (свыше 10%) стали, обладающие особыми свойствами – коррозионной стойкостью, жаро – стойкостью, жаропрочностью, износостойкостью и др

Углеродистые стали

К углеродистым  сталям относят стали, не содержащие специально введенные легирующие элементы.

Конструкционные углеродистые стали.

Стали  углеродистые  обыкновенного  качества  (сталь  с  достаточно высоким содержанием вредных примесей S  и P) обозначают согласно ГОСТ 380-94.

Эти наиболее  широко  распространенные  стали  поставляют  в  виде проката  в  нормализованном  состоянии  и  применяют  в  машиностроении, строительстве и в других отраслях.

Углеродистые  стали  обыкновенного  качества  обозначают  буквами:

Ст  и  цифрами  от  0  до  6.   Цифры — это  условный  номер  марки.  Чем  больше число, тем больше содержание углерода, выше прочность и ниже пластичность.

Перед символом Ст указывают группу гарантированных свойств: А, Б,В.  Если указание о группе отсутствует, значит предполагается группа  А.

Например, СТ3; БСт4; ВСт2.

Сталь  обыкновенного  качества  выпускается  также  с  повышенным содержание  марганца  (0,8-1,1%  Mn)/  В  этом  случае  после  номера марки добавляется буква Г.   Например, БСТ3Гпс.

 После номера  марки стали указывают степень  раскисления:  кп – кипящая, пс – полуспокойная, сп – спокойная сталь.  

    Например, ВСт3пс.

Таблица 2. – Структура обозначения углеродистых сталей.

Группа

стали

Обозначение Номер

стали

Степень

раскисления

Категория
А Ст 0 1, 2, 3
1, 2, 3, 4 кп, пс, сп
5, 6 пс, сп
Б БСт 1, 2, 3, 4 кп, пс, сп 1, 2
5, 6 пс, сп
В ВСт 1, 2, 3, 4 кп, пс, сп 1, 2, 3, 4, 5
5 пс, сп

 

Таблица 3. –Значение букв и цифр, употребляющихся при маркировке сталей обыкновенного качества.

Обозначение Расшифровка обозначения
А Группа сталей, поставляемая с гарантированными механическими свойствами. Обычно при обозначении сталей букву  А опускают.
Б Группа сталей, поставляемая с гарантированным химическим составом.
В Группа сталей, поставляемая с гарантированными химическими и механическими свойствами.
Ст Сокращенное обозначение термина «сталь»
0 – 6 Условные марки стали.
Г Наличие буквы Г после номера стали означает повышенное содержание марганца.
Кп
Сталь «кипящая», раскисленная только ферромарганцем.
Пс Сталь «полуспокойная», раскисленная ферромарганцем и алюминием.
Сп Сталь «спокойная», то есть полностью раскисленная.

 

Примеры обозначения и расшифровки:

  1. БСТ2кп –  сталь конструкционная углеродистая обыкновенного качества, группы  Б, поставляемая с гарантированным химическим составом, номер 2,  кипящая.
  1. СТ5Гпс –  сталь конструкционная обыкновенного качества , группы , поставляемая с гарантированными механическими свойствами, номер 5, содержание марганца до 1%, полуспокойная.
  1. ВСт3сп – сталь конструкционная углеродистая обыкновенного качества, группы  В, поставляемая с гарантированным химическим составом и механическими свойствами, номер 3,  спокойная.

Обозначение углеродистых качественных конструкционных сталей

Качественная конструкционная сталь – сталь с заметно меньшим содержанием серы, фосфора и других вредных примесей. Обозначается согласно ГОСТ 1050-88.

Сталь  маркируют  двузначными  числами,  которые  обозначают  содержание углерода в сотых долях процента, и поставляют с гарантированными показателями  химического  состава  и  механических  свойств.  По  степени раскисления  сталь  подразделяют  на  кипящую  (кп),  полуспокойную  (пс), спокойную  (без  указания  индекса).  Буква  Г  в  марках  сталей  указывает  на повышенное содержание марганца (до 1%).

Примеры обозначения и расшифровки

  1. Сталь 05кп –сталь конструкционная низкоуглеродистая, качественная, содержащая углерода 0,05%, кипящая.
  1. Сталь  25  –  сталь  конструкционная  низкоуглеродистая, качественная содержащая углерода 0,25%, спокойная.
  2. Сталь 60Г  –  сталь конструкционная среднеуглеродистая,  качественная, содержащая углерода 0,6%, арганца 1%, спокойная.

 

Автоматные стали

Обозначение автоматных сталей 

По ГОСТ 1414-75  эти стали маркируют буквой  А и цифрами, показывающими среднее содержание углерода в сотых долях процента.          Применяют следующие марки автоматной стали:  А12,А20, АЗО, А40Г.

Из  стали А12 готовят неответственные детали, из стали других марок  — более ответственные детали, работающие при значительных напряжениях и  повышенных давлениях. Сортамент автоматной стали предусматривает изготовление  сортового  проката  в  виде  прутков  круглого,  квадратного  и шестигранного сечений. Эти стали не применяют для изготовления сварных конструкций.

Примеры обозначения и расшифровка

АС12ХН  – сталь автоматная легированная, низкоуглеродистая, содержащая 0,12 % углерода, 1% хрома и никеля.

Котельные стали.

Стали листовые для котлов и сосудов, работающих под давлением, применяют для изготовления паровых котлов, судовых топок,

камер горения газовых турбин и других деталей. Они должны работать при переменных давлениях и температуре до 450″С. Кроме того, котельная сталь должна хорошо свариваться. Для получения таких свойств в углеродистую сталь вводят технологическую добавку (титан) и дополнительно раскисляют ее алюминием. Выпускают следующие марки углеродистой котельной стали 12К, 15К, 16К, 18K.20K.22Kc содержанием в них углерода от 0,08 до 0,28%.

Эти  стали  поставляют  в  виде  листов  с  толщиной  до  200  мм  и  поковок  в состоянии после нормализации и отпуска.

 

Инструментальные углеродистые стали.

Обозначение инструментальных углеродистых сталей

Инструментальный углеродистые стали, маркируют в соответствии с ГОСТ1435-90.

Инструментальные  углеродистые стали выпускают следующих марок:

У7.У8ГА.У8Г, У9, У 10, У 11, У 12 и  У 13. Цифры указывают на содержание углерода в десятых долях процента. Буква Г после цифры означает, что сталь имеет повышенное содержание марганца. Марка инструментальной углеродистой стали высокого качества имеет букву А.

Примеры обозначения и расшифровки 

  1. У12 – сталь инструментальная, высокоуглеродистая, содержащая 1,2% углерода, качественная.
  1. У8ГА –  сталь  инструментальная,  высокоуглеродистая, содержащая 0,8% углерода,   1% марганца, высококачественная.
  1. 3. У9А – сталь инструментальная, высокоуглеродистая, содержащая 0,9% углерода, высококачественная.

 

Легированные стали.

 Легированной называют сталь со специально введенным одним или более легирующим элементом.

Обозначение легированных сталей 

Легированные стали маркируются комбинацией цифр и заглавных букв алфавита. В обозначении нет слова «сталь» или символа «Ст». Например, 40Х, 38ХМ10А, 20Х13. Первые две цифры обозначают содержание углерода  в сотых долях процента. Следующие буквы являются сокращенным  обозначением элемента. Цифры, стоящие после букв, обозначают содержание этого элемента в  целых процентах. Если за буквой не стоит  цифра, значит содержание этого элемента до 1%.

Таблица 4. – Обозначение элементов марка.

Ю-АI Алюминий C-Si Кремний A-N Азот
Р-В Бор Г- Mn Марганец Д –Cu Медь
Ф-V Ванадий М-Мо Молибден Е-Se Селен
В-W Вольфрам Н-Ni Никель Ц-Zr Цирконий
Ж-Fe Железо T-Ti Титан Б-Nb Ниобий
К- Co Кобальт Та – Тантал Х- хром

 

Для изготовления измерительных инструментов применяют X, ХВГ.

Стали для штампов: 9Х, Х12М, 3Х2Н8Ф.

Стали для ударного инструмента: 4ХС, 5ХВ2С.

Обозначение быстрорежущих сталей

Все  быстрорежущие  стали  являются  высоколегированными.  Это  стали  для оснащения рабочей части резцов, фрез, сверл и т.д.

Маркировка  быстрорежущих  сталей  всегда  начинается  с  буквы  Р  и  числа, показывающего содержание  вольфрама в процентах. Наиболее распространенными марками являются Р9, Р18, Р12.

Легированные стали с особыми свойствами.
  1. Коррозионностойкие стали.  Коррозионностойкой (или нержавеющей) называют  сталь,  обладающую  высокой  химической  стойкостью  в агрессивных средах. Коррозионностойкие стали получают легированием низко-  и среднеуглеродистых сталей хромом, никелем, титаном, алюминием, марганцем.  Антикоррозионные свойства сталям придают  введением в них большого количества хрома или хрома и никеля. Наибольшее распространение получили хромистые и хромоникелевые стали.

Например, хромистые стали 95Х18, 30Х13, 08Х17Т.

Хромоникелевые  нержавеющие  имеют  большую  коррозийную  стойкость, чем хромистые стали, обладают повышенной прочностью и хорошей технологичностью в отношении обработки давлением.

Например, 12Х18Н10Т, 08Х10Н20Т2.

  1. Жаростойкие обладают стойкостью против химического разрушения в газовых средах, работающие в слабонагруженном состоянии.

Жаропрочные стали  – это стали, способные выдерживать механические нагрузки без существенных деформаций при высоких температурах. К числу жаропрочных относят стали, содержащие хром, кремний, молибден, никель и др.

Например, 40Х10С2М, 11Х11Н2В2МФ.

3.Износостойкие – стали, обладающие повышенной стойкостью к износу:

шарикоподшипниковые, графитизированные и высокомарганцовистые.

Особенности обозначения подшипниковых сталей.

Маркировка начинается с буквы Ш, цифра, стоящая после буквы Х, показывает содержание хрома в десятых долях процента.

Например, ШХ9, ШХ15ГС. 

Примеры обозначения и расшифровки

  1. 40ХГТР – сталь конструкционная, лкгированная, качественная, содержащая 0,4% углерода и по 1% хрома, марганца, титана, бора, остальное – железо и примеси.
  2. 38Х2МЮА – сталь конструкционная, легированная, высококачественная, содержащая 0,38% углерода, 2% % хрома, 1%   молибдена, алюминия, остальное- железо и примеси.
  3. ХВГ – сталь конструкционная, легированная, качественная,  содержащая 1% углерода и по 1% хрома, марганца, остальное – железо и примеси.
  4. ШХ15 – сталь подшипниковая, инструментальная, качественная, содержащая 1% углерода, 1,5% хрома, остальное-железо.
  1. Р10К5Ф5 – сталь быстрорежущая, инструментальная, качественная,  содержащая 1% углерода, 10% вольфрама, 5% кобальта, 5% ванадия, остальное-железо.

 

 

 

 

 

Серый чугун | Литейные сплавы, их свойства и приготовление

Серый чугун представляет собой сплав железа с углеродом, в котором содержится 2,5—3,7% углерода, 1,0—2,9% кремния, 0,2—1,1% марганца, до 0,3% фосфора и до 0,12% серы. Углерод, кремний и марганец улучшают механические и литейные свойства сплава, а фосфор и сера являются вредными примесями. Фосфор придает чугуну хрупкость, а сера вызывает отбел в тонких частях отливки и понижает жидкотекучесть расплава. Поэтому их содержание в сплаве должно быть минимальным.

Серый чугун широко применяют в машиностроении, так как он дешев, хорошо обрабатывается резцом, обладает высокими литейными и механическими свойствами (см. табл. 1). Однако он имеет низкую вязкость — хрупкость и потому отлитые из чугуна детали не должны подвергаться ударному воздействию. Хрупкость серого чугуна обусловливается тем, что в нем углерод находится в виде пластиночек графита (рис. 14, а), которые являются надрезами, нарушающими сплошность металлической основы.

По ГОСТ 1412—70 серые чугуны подразделяются на марки: СЧ 12—28, СЧ 15—32, СЧ 18—36, СЧ 21—40, СЧ 24—44, СЧ 28—48, СЧ 32—52, СЧ 36—56, СЧ 40—60 и СЧ 44—64. В марках «С» означает серый, «Ч» — чугун, две первые цифры — предел прочности при растяжении в кгс/мм2; а две последние цифры — предел прочности при изгибе в тех же единицах. Малопрочный чугун марки СЧ 12—28 идет на отливку фундаментных плит, строительных колонн и других неответственных изделий. Чугун средней прочности марок СЧ 15—32 и СЧ 18—36 применяют для производства разнообразных отливок деталей станков, сельскохозяйственных машин и др. Особо прочный чугун марок с СЧ 21—40 до СЧ 36—56 используется для производства деталей насосов, компрессоров, турбин и других ответственных деталей машиностроения. Наиболее ответственные и крупные детали машиностроения и других отраслей народного хозяйства отливаются из наиболее прочного чугуна марок СЧ 40—60 и СЧ 44—64, который был освоен в последние годы.

Плавка серого чугуна ведется главным образом в шахтных печах — вагранках. Современные вагранки делятся на два типа: с копильником — применяемые при крупном литье, когда необходимо скопить большое количество расплава, и без копильника — для получения расплава с более высокой температурой, но в меньших количествах. Производительность вагранок 5—30 т чугуна в час.


Рис. 14. Схемы микроструктур серого чугуна:
а — обыкновенного, б — высокопрочного, 1 — графит пластинчатый, 2 — графит шаровидный, 3 — металлическая основа

Химический состав и мехсвойства чугуна с пластинчатым графитом ГОСТ 1412-85

Справочная информация

В Компании ГП Стальмаш Вы можете купить круг чугунный со следующими параметрами:
Отливки чугунные ГОСТ 26358-84
Диаметр круга от 30 до 690 мм, длина от 300 до 600 мм.
(По согласованию с заказчиком рассматриваются РАЗЛИЧНЫЕ РАЗМЕРЫ, возможна отливка квадрата, плиты, втулки…).

ГОСТ 1412-85 чугун с пластинчатым графитом СЧ10, СЧ15, СЧ18, СЧ20, СЧ21, СЧ24, СЧ25, СЧ30, СЧ35.

Оперативная и полная информация о наличии, ценах, условиях и сроках отгрузки по телефонам ГП Стальмаш:
+7 (343) 268-7815, +7 (950) 208-1282, +7 (902) 255-6262

ЧАСЫ РАБОТЫ: Пн — Пт: с 06:30 до 16:00, время Московское, во внерабочее время отправляйте запрос на E-mail: [email protected] или через форму «Обратная связь»

Химический состав и механические свойства серого чугуна с пластинчатым графитом (ГОСТ 1412-85)


Марка чугуна

Химический состав, %

Механические свойства

Углерод

Кремний

Марганец

Фосфор

Сера

Хром

Никель

Предел прочности, кг/мм2

Стрела прогиба, расстояние между опорами 600 и 300 мм

Твердость по Бриннелю, НВ

Не более

При растяжении

При изгибе

При сжатии

СЧ12-28

3,3 — 3,6

2,2 — 2,5

0,6 — 1

0,4

0,15

0,15

0,5

12

28

50

6/2

143-229

СЧ15-32

3,2 — 3,5

2,0 — 2,4

0,7 — 1,1

0,4

0,15

0,15

0,5

15

32

65

8/2,5

163-229

СЧ18-36

3,1 — 3,4

1,7 — 2,1

0,8 — 1,2

0,3

0,15

0,3

0,5

18

36

70

8/2,5

170-229

СЧ21-40

3,0 — 3,3

1,3 — 1,7

0,8 — 1,2

0,3

0,15

0,3

0,5

21

40

75

9/3

170-241

СЧ24-44

2,9 — 3,2

1,2 — 1,6

0,8 — 1,2

0,2

0,15

0,3

0,5

24

44

85

9/3

170-241

СЧ28-48

2,8 — 3,1

1,1 — 1,5

0,8 — 1,2

0,2

0,12

0,3

0,5

28

48

100

9/3

170-241

СЧ32-52

2,7 — 3,0

1,1 — 1,5

0,8 — 1,2

0,2

0,12

0,3

0,5

32

52

110

9/3

187-255

СЧ35-56

2,6 — 2,9

1,1 — 1,5

1,0 — 1,4

0,2

0,12

0,3

0,5

35

56

120

9/3

197-269

СЧ38-60

2,5 — 2,8

1,1 — 1,5

1,0 — 1,4

0,2

0,12

0,3

0,5

38

60

130

9/3

207-269

В маркировке СЧ две первые цифры означают среднюю величину предела прочности при растяжении, две вторые — предел прочности при изгибе

Чугуны — Марки — Обозначения

По ГОСТ 1412-85 марка серого чугуна определяется показателем временного сопротивления чугуна при растяжении. Условное обозначение марки включает буквы СЧ — серый чугун и цифровое обозначение величины минимального временного сопротивления при растяжении в МПа х 10  [c.181]

Пример условного обозначения чугунного прутка марки НЧ-1 диаметром 12 мм Пруток 12 НЧ-1 ГОСТ 2671—70.  [c.18]


Обозначение марки состоит из букв КЧ и стоящих после них чисел, указывающих предел прочности при растяжении в килограммах на квадратный миллиметр и относительное удлинение в процентах. Например, в марке КЧ 35—10 число 35 обозначает предел прочности при растяжении в килограммах на квадратный миллиметр, а число 10 — относительное удлинение в процентах. В автомобилестроении широко применяется ковкий чугун КЧ 35—10. Чугун этой марки обладает высокой прочностью. Из ковкого чугуна изготовляют картер заднего моста, коробку дифференциала, картер рулевого механизма, ступицы передних и задних колес, кронштейны педалей сцепления и тормоза, кронштейн передней рессоры и др.  [c. 77]

Марки серого чугуна состоят из условного обозначения наименования чугуна (СЧ — серый чугун), предела прочности при растяжении (первые две цифры) и предела прочности при изгибе (вторые две цифры).  [c.23]

Например, обозначение СЧ 15-32 показывает, что чугун этой марки должен иметь а , = 15 кг/мм и Оц г — 32 кг/мм .  [c.181]

Пример условного обозначения чугунного прутка марки НЧ-2 диаметром 10 мм Пруток 10 НЧ-2 ГОСТ 2671—70 .  [c.36]

В обозначении марки чугуна первое число означает предел прочности при растяжении, а второе — при изгибе.  [c.268]

Пример условного обозначения серого чугуна марки СЧ 21-40 Чугун СЧ 21-40 ГОСТ 1412—70.  [c.268]

Для изготовления литых деталей применяют чугуны (серый, модифицированный, высокопрочный, ковкий, легированный), сталь (углеродистую, легированную), медные, магниевые, алюминиевые, цинковые, свинцовые, оловянные и никелевые литейные сплавы, которые хорошо заполняют в расплавленном сосгоянии литейную форму и обладают после затвердевания необходимыми механическими, физическими и химическими свойствами. Марку материала детали указывают в соответствующей графе основной надписи чертежа. Многие литейные сплавы имеют в обозначении марки букву Л, которая характеризует литейные свойства материала и указывает способ изготовления детали.  [c.256]

В обозначении марки чугуна первые две цифры — предел прочности при растяжении, вторые две цифры — предел прочности при изгибе.  [c.248]

Марки ковкого чугуна устанавливает ГОСТ 1215—79 КЧ 30-6 КЧ 33-8 КЧ 35-10 КЧ 37-12 КЧ 45-7 КЧ 50-5 и т.. I. П р и м е р обозначения  [c.202]

Пример обозначения шкива для приводных клиновых ремней с сечением А, с двумя канавками, расчетным диаметром dp = 224 мм, с цилиндрическим посадочным отверстием d = 28 мм, из чугуна марки СЧ 1Я-36 по ГОСТ 1412—70  [c.483]


Стандартные марки серых чугунов обозначаются по ГОСТ 1412—79 буквами С — серый и Ч — чугун. После букв следует число, означающее предел прочности при растяжении (кгс/мм ). По ГОСТ 1412—70 в марке чугуна добавлялось второе число — предел прочности при испытании на изгиб (кгс/мм ). Пример условного обозначения отливки из серого чугуна марки СЧ 25  [c.316]

Стандартные марки антифрикционных чугунов обозначаются гремя буквами. Буквенная часть марок означает АЧ — антифрикционный чугун, С — серый чугун (о пластинчатым графитом), К ковкий (с компактным графитом), В — высокопрочный (о шаровидным графитом). Пример условного обозначения отливки из антифрикционного чугуна марки АЧС-5  [c.316]

Серый чугун называется так потому, что его излом имеет серый цвет (вследствие присутствия графита). В марках серых чугунов, например СЧ-12-28, СЧ-15-32 и т. д., две первые цифры означают предел прочности при растяжении, а вторые— предел прочности при изгибе в килограммах на один квадратный миллиметр. Пользуясь этой системой условных обозначений, можно сказать, что чугун марки СЧ-18-36 имеет прочность на растяжение, равную 18 /сг/жж , а на изгиб — 36 кг мм .[c.152]

Чугун (5). Условное обозначение марок чугуна (6). Механические свойства отливок из серого чугуна (7). Примерное назначение отливок из серого чугуна (8). Механические свойства отливок из ковкого чугуна (9). Примерное назначение отливок из ковкого чугуна (10). Сравнительные показатели механических свойств ковкого чугуна и других машиностроительных материалов (10). Марки антифрикционного чугуна в зависимости от формы включения графита (11). Примерное назначение и предельные режимы работы литых деталей пз антифрикционного чугуна (11). Механические свойства отливок из высокопрочного чугуна (12). Примерное назначение отливок из высокопрочного чугуна (13). Механические свойства отливок из жаростойкого чугуна (13). Примерное назначение отливок из жаростойкого чугуна (14). Физико-механические свойства отливок из кислотостойкого чугуна (15). Примерное назначение отливок из кислотостойкого чугуна (15).  [c.536]

Условное обозначение марки чугуна по ГОСТ  [c. 33]

Стандарт Японии Л8 С 5501 включает шесть марок чугуна. Условное обозначение марки включает буквы РС и цифровое обозначение величины минимального временного сопротивления при растяжении в МПа х 10 например  [c.185]

Примечание В обозначении марки АЧ — антифрикционный чугун С — серый с  [c.194]

Твердые сплавы делятся на три группы. Вольфрамовые изготовляются на основе карбида вольфрама и кобальта, содержащегося в количестве от 3 до 15 %. Маркируются буквами ВК и цифрой, показывающей содержание кобальта в процентах (ВК2, ВК6, ВКЮ). Чем выше содержание кобальта, тем выше вязкость сплава. На свойства сплавов влияет размер зерна карбидов. С уменьшением размера зерна возрастает износостойкость, но несколько снижается прочность. В обозначениях марки сплава с мелким зерном добавляется буква М (ВКЗ-М, ВК6-М). Вольфрамовые сплавы используются при обработке чугунов, сплавов высокой хрупкости, неметаллических материалов.  [c. 191]

В обозначении марки буквы ВЧ означают, что чугун высокопрочный, цифры — минимальное значение временного сопротивления при растяжении (МПа 10 ).  [c.150]

В ГОСТ 28394-89 для изготовления отливок предусмотрены четыре марки ЧВГ (табл. 8.14). Марка чугуна определяется временным сопротивлением разрыву при растяжении сТд и условным пределом текучести ар 2- Обозначение марки включает буквы Ч — чугун, ВГ — форма графита (вермикулярный графит), цифры — минимальное значение временного сопротивления разрыву при растяжении (МПа 10 ).  [c.159]

В обозначении марок легированного чугуна буквы и цифры имеют такое же значение, как и в марках легированных сталей буква Ч означает чугун, буква Ш — шаровидную форму графита.  [c.167]

Антифрикционные чугуны применяют для работы в узлах трения (со смазкой), подшипников скольжения, втулок, вкладышей. В качестве антифрикционных используют нелегированные или низколегированные серые чугуны с пластинчатым графитом АЧС-1-АЧС-6, высокопрочные чугуны с шаровидным графитом АЧВ-1, АЧВ-2 и ковкие чугуны АЧК-1, АЧК-2 (табл. 7.13). В обозначении марки антифрикционного чугуна цифра — это порядковый номер чугуна (ГОСТ 1585-85).  [c.420]


В обозначении марки АЧ — антифрикционный чугун, С — серый с пластинчатым графитом, В — высокопрочный с шаровидным графитом, К — ковкий с компактным графитом цифра — порядковый номер марки.  [c.420]

Эти чугуны, легированные хромом, кремнием, алюминием, никелем и другими элементами, в соответствии с ГОСТ 7769-82 объединены в одну группу — чугун легированный для отливок со специальными свойствами. Марки рассматриваемых чугунов начинаются с буквы Ч , за которой следуют те же обозначения легирующих элементов и их содержание, что и в марках легированных сталей. Буква Ш в конце марки обозначает, что чугун — с шаровидным графитом.  [c.421]

Пример обозначения втулки d = 32 мм из чугуна марки АСЧ-1 Втулка 32 АСЧ-1 МН 2776-31 то же, из чугуна марки АКЧ-2  [c.144]

Пример обозначения марки серого чугуна Чугун СЧ 21-40 ГОСТ 1412—54.[c.572]

В обозначение марки отливки из ковкого чугуна входят буквы КЧ (ковкий чугун) и числа, указывающие первое число — временное сопротивление разрыву, второе — относительное удлинение (%).  [c.136]

Цифры в обозначении марки серого чугуна означают предел прочности  [c.6]

Примечание. Буквенные обозначения А—антифрикционный СЧ, ВЧ и КЧ—соответственна серый, высокопрочный и ковкий чугун. Чугун марки АКЧ-2 имеет твердость НВ 167—197.  [c.16]

Серые чугуны маркируют буквенно-числовым обозначением буквы СЧ означают серый чугун, следующие за ними два двузначных числа показывают первое — предел прочности при растяжении, второе — предел прочности при изгибе. Например,. марка СЧ-21-40 показывает, что чугун этой марки должен иметь ==21 кГ1мм и =40 кГ1мм .  [c.126]

Марки высокопрочного чугуна состоят из условного обозначения наименования чугуна (ВЧ—высокопрочный чугун), предела прочности при растяжении в кПмм (первые две цифры) и относительного удлинения Б процентах (последние цифры после черты).[c.24]

В последние годы в номенклатуре марок сплавов видиа произошли значительные изменения. Вместо сплавов карбид вольфрама—карбид титана—кобальт, обозначавшихся как F1, S1, S2, S3, появились сплавы с добавками карбида тантала (карбида ниобия) и повышенным содержанием кобальта. Эти новые марки сплавов носят обозначения FT1, TTI, ТТ2, ТТЗ и соответствуют по областям применения прежним маркам F1, S1, S2, S3. Кроме того, введены марка ТТ4, для особо тяжелых работ и марка А1—универсальная, т. е. пригодная как для обработки чугуна, так и для обработки сталей.  [c.557]

Стандартные марки высокопрочных чугунов обозначаются буквами В — высокопрочный, Ч — чугун. После букв следуют числа — такие же, как и при обозначении марок ковких чугунов первое число — предел прочности при растяжении (кгс/мм ), второе — относительное удлинение (%). Прид)ер условного обозначения отливки из высокопрочного чугуна о шаровидным графитом марки ВЧ 60-2  [c. 316]

Манганиновые провода 149 Манжеты резиновые 254 Манильские канаты 256 Манометрические трубы 61 Марганец 98, 101 Марганец-никелевые ферриты 114 Марганцовая электродная руда 275 Марганцовистая сталь 16 Марганцовистый никель 108 Марганцовокислый калий 283 Марки сплавов (расшифровка составляющих обозначений) 5. 28 Маркировка стального проката 9 Маркировочные краски 225 Мартеновская сталь 12 Мартеновский передельный чугун 67 Мартенса теплостойкость 153 Мартенситные стали 28 Маршалит 277 Масла растительные 192 Масла смазочные 301—307, 312—313 Маслобензостойкая резина 244 Маслоемкость пигмента 190 Маслостойкость лакокрасочной пленки 190 Масляные лаки и эмали 208—210 Масляные коллоиднографитовые препараты 269  [c.340]

Стандарт США А8ТМ А 48 включает де-В5пъ марок чугуна. Условное обозначение марки включает цифровое обозначение и букву «В» Число определяет временное сопротивление разрьшу (фунтах/кв. дюйм), например  [c.185]

Обозначение марок высокопрочного чугуна начинается с букв ВЧ — высокопрочный чугун. Первое число в марке— минимальное допускаемое значение предела прочности при растяжении в кГ1мм , второе — минимальное допускаемое значение относительного удлинения в процентах. Например, чугун марки  [c.95]

Данные о материале, из которого должна быть изготовлена деталь, вносят в графу 3. Указывают наименование, марку материалов и номер стандарта, например сгалб 45Г2 ГОСТ 1950—60. В том случае, если в обозначении марки содеожится сокращенное наименование материала, например Ст (сталь), СЧ (серый чугун), КЧ (ковкий чугун), Бр (бронза), допускается не писать наименование, например СЧ 18—36 ГОСТ 1412—58.  [c.14]


Предел прочности серого чугуна — Справочник химика 21

    Пределом прочности на растяжение называют отношение величины нагрузки Р при разрыве образца к площади его первоначального поперечного сечения F (мм ) ав =PIF. У серого чугуна Ств = 100…200 МПа, у рядовой стали [c.64]

    Серый чугун. Выпускается 10 марок серого чугуна (ГОСТ 1412—54) СЧ 00, СЧ 12—28, СЧ 15—32, СЧ 18—36, СЧ 21-40, СЧ 24—44, СЧ 28—48, СЧ 32—52., СЧ, 35—56 и СЧ 38—60. Первая цифра в обозначении марки соответствует пределу прочности металла при растяжении, вторая цифра -пределу прочности при изгибе (в кг мм ). [c.82]


    Предел усталости серого чугуна при изгибе (испытание гладких образцов) обычно колеблется в пределах 0,3—0,5 от предела прочности. [c.129]

    Для обозначения чугунов и сталей принята определенная система обозначений. Серые чугуны маркируются буквами СЧ с указанием пределов прочности при растяжении и при изгибе, например, СЧ12-28. Ковкий чугун обозначается буквами КЧ с указанием предела прочности при растяжении и относительного удлинения, например КЧ50-4. [c.47]

    Расчет стальных цилиндров следует производить по пределу текучести, причем для большинства сортов стали в формуле (УП. 21) V = = = 1. Расчет чугунных цилиндров ведут по пределу прочности, причем для серых и легированных чугунов V = = 0,3. [c.322]

    Сокращенное обозначение серых чугунов состоит из букв СЧ (что означает серый чугун) и двух двузначных чисел, первое из которых характеризует предел прочности на растяжение в кг/мм , а второе — предел прочности на изгиб в кг/мм . Так, маркировка СЧ24—44 обозначает серый чугун с прочностью на растяжение 24 кг/мм и на изгиб 44 кг/мм . [c.22]

    Например, СЧ15 означает серый чугун с временным сопротивлением (пределом прочности) при растяжении = 15 кгс/мм (150 МПа). Ранее серый чугун обозначался следующим образом СЧ 12-28 СЧ 15-32 СЧ 40-60, где цифры 12,15,40 — это предел прочности (временное сопротивление), кгс/мм , при изгибе. [c.346]

    Марки чугуна в изделиях обозначаются буквами и цифрами. Серый чугун в отливках маркируется буквами СЧ с добавлением двух чисел, из которых первое указывает предел прочности при растяжении, а второе — предел прочности при изгибе. Так, например, марка СЧ 18-36 обозначает серый чугун, имеющий предел прочности при растяжении 18 кПмм и при изгибе 36 кГмм . Отливки из ковкого чугуна маркируются буквами КЧ и числами, из которых первое показывает предел прочности при растяжении, а второе — относительное удлинение. Марка КЧЗО-6 обозначает ковкий чугун, имеющий предел прочности при растяжении 30 кПмм и относительное удлинение 6%. [c.18]

    Высокопрочный чугун с шаровидным графитом в отличие от серого чугуна вызывает меньшие концентрации напряжений и позволяет повысить прочность металлической основы чугуна на 70—90 /о при наличии некоторой пластичности. Химический состав нелегированного высокопрочного учгуна с шаровидным 1 рафитом колеблется до ввода магния и ферросилиция в следующих пределах 2,5—4,0% С 0,8—6,0% 81 0,5—1,2% Мп до 0,2% Р, до 0,14% 8, [c.132]


    Данные табл, 110 показывают влияние пониженных температур на предел прочности серого чугуна трех видов.[c.288]

    В сером чугуне углерод содержится главным образом в виде пластинок графита. Эти малопрочные пластинчатые включения углерода пронизывают металлическую основу материала и служат центрами разрушения серого чугуна при растяжении. Это влияние графита гораздо меньше сказывается при сжатии чугуна. Поэтому прочность чугуна при сжатии примерно в четыре раза больше прочности при растяжении. Поэтому серый чугун применяют при изготовлении деталей, работающих на сжатие, или для ненагруженных деталей (станины станков, корпуса редукторов и насосов, поршневые кольца двигателей и др.). Серый чугун характеризуется высокими литейными свойствами низкая температура кристаллизации, текучесть в жидком состоянии, малая усадка. Он служит основным материалом для литья. Кроме углерода, серый чугун всегда содержит другие элементы. Важнейшие из них — это кремний и марганец. В большинстве марок серого чугуна содержание углерода лежит в пределах 2,4—3,8%, кремния 1—4% и марганца до 1,4% (масс. ). [c.630]

    Чугунные трубопроводы из антихлора и ферросилида вследствие большой твердости и хрупкости требуют особенно осторожного обращения при транспортировании и монтаже. Хрупкость их так велика, что изготовленные из них изделия (трубы и детали) разрушаются от незначительных ударов, а также от местных перегревов и резких перепадов температур. Предел прочности высококремнистого чугуна составляет 7—8 кгс/см , т. е. вдвое ниже, чем у серого чугуна. Из всех видов механической обработки для них применяют только шлифовку и резку абразивными кругами. Сверлить отверстия и нарезать резьбу на изделиях из этих материалов практически невозможно. [c.260]

    Ковкий чугун наиболее рационально применять там, где серый чугун, а иногда и сталь не позволяют получить изделия нужной конфигурации при высоких механических свойствах. Ковкий чугун дает возможность отливать детали с довольно тонкой стенкой (3—6 мм) при хорошей чистоте поверхности отливок. Он характеризуется высоким отношением предела текучести к пределу прочности (около 67%), высоким пределом усталости, хорошей циклической вязкостью, высокой износоустойчивостью и др. (табл. 18). [c.31]

    По ГОСТ 1412-54 серый чугун маркируется по прочности Металла в отливке. Обозначения марок серых чугунов начинаются с букв СЧ — серый чугун, далее следуют два двузначных числа, разделенные дефисом (черточкой), показывающие минимальные пределы прочности чугуна в кГ мм соответственно при испытаниях на растяжение и изгиб. [c.50]

    Характер окружающей атмосферы также влияет на скО рость р-оста чугуна. Так, серый чугун, содержащий 3,48% углерода и 2% кремния, в результате пребывания при 400°С в атмосфере водяного пара в течение 54 недель увеличивается в объеме приблизительно на 3% предел прочности при растяжении снижается с 12,9 до 7,4 кГ/мм . [c.53]

    Дальнейшие исследования показали наличие связи между затуханием и скоростью распространения ультразвуковых колебаний, с одной стороны, и механическими характеристиками серых чугунов — с другой. На рис. 51, б приведены данные выполненных в НИИхиммаше исследований зависимости предела прочности серого чугуна при растяжении от скорости распространения ультразвука в нем. Зависимость скорости распространения ультразвука, коэффициента затухания и твердости от площади, занимаемой графитом в образцах из серого чугуна, представлена на рис. 52. Наличие зависимости между прочностью серого чугуна и скоростью распространения ультразвуковых колебаний было показано в работе [153]. Автор отмечает возможность выявления отбела чугуна, так как скорость ультразвука в этем случае резко возрастает. [c.84]

    В обозначение марки чугуна входит предел прочности на растяжение и предел прочности на изгиб. Например, серый чугун, имеющий предел прочности на растяжение 372 Мн1м и предел прочности на изгиб 590 Мн м , обозначается С438-60, менее прочный чугун СЧ21-40. [c.138]

    Высокопрочный чугун с шаровидным графитом (ВЧШГ) отличается от серого чугуна с пластинчатой формой графита тем, что обладает высокими прочностными свойствами, близкими к свойствам углеродистой стали (предел прочности при растяжении, предел текучести и относительное удлинение), и повышенной коррозионной стойкостью. Основные требования к трубам, серийно производимым ОАО Липецкий металлургический завод Свободный сокол , к их качеству, механической прочности и т. д. определены техническими условиями ТУ 14-154-23—90, соответствующими требованиям международного стандарта ISO 2531. Напорные трубы отливаются центробежным способом из высокопрочного чугуна с шаровидным графитом и имеют следующий химический состав (табл. 3.1.6.11). [c.867]


    Низкие механические свойства серого чугуна (предел прочности при растяжении и изгибе, ударная вязкость), а также склонность его к росту (необратимому увеличению объема) при повышенных температурах, сопровождающемуся резким снижением прочности, ограничивает применение его в нефтезаводском оборудовании для высоконагруженных элементов, при ударных и знакопеременных нагрузках, а также при повыпюнпых температурах. [c.34]

    Высокие литейные свойства серого чугуна (легко заполняет форму, имеет незначительную усадку, хорошую плотность отливки) позволяют обрабатывать его резанием и применять для изготовления малонапряженных деталей неответственного назначения, не подвергающихся ударным нагрузкам и работающим в основном на сжатие. Предел прочности чугуна при сжатии в несколько раз выше его прочности прп растяжеппи и изгибе. Применение чугунного литья допускается при температуре стенки аппарата от —15 до +250° С. [c.57]

    Серый чугун значительно лучше работает на сжатие, чем на растяжение предел прочности чугуна на сжатие колеблется от 50 до 100 кГ1мм . Модуль упругости серых чугунов увеличивается с повышением напряжения. Величина ударной вязкости серого чугуна весьма невелика 0,1—0,4 кГ м1см —  [c.47]

    Серый чугуа. Серым чугуном называется железный сплав, со-, держащий 2,8—3,8% углерода, 1,0—2,5% кремния и незначительные примеси марганца, фосфора и серы. Такой -чугун хорошо-отливается и обрабатывается. Применяют его для изготовлениа водопроводных и канализационных труб и различной арматуры. Чугун марки СЧ 15-32, используемый в качестве конструкционного материала для арматуры, имеет предел прочности при растяжении / 150 МПа (15кге/мм ). [c.6]

    Ковкий чугун широко применяется в автотракторостроении, транспортном машиностроении, для изготовления различной арматуры и т. п. Наиболее рационально его применять там,где серый чугун, а в ряде случаев и сталь не позволяют получить нужной сложной конфигурации изделий при высоких механических и других свойствах. Ковкий чугун дает возможность отливать детали с довольно тонкой стенкой (3—6 мм) при очень хорошей чистоте поверхности отливок. Он характеризуется высоким отношением предела текучести к пределу прочности (первый составляет около 67% от второго), высоким пределом усталости, хорошей циклической вязкостью, высокой износоустойчивостью и т. п. Однако в нефтяной, нефтехимической и газовой промышленности он не получил широкого применения. В настоящее время ковкий чугун используют для изготовления деталей водогазопаропроводной арматуры, корпусов, вентилей, кранов, задвижек и т. п. [c.174]

    Все виды отливок из серого чугуна независимо от их назначения стандартизованы. На отливки из серого чугуна (в этом числе и модифицированного) с пластинчатым графитом распространяется ГОСТ 1412-54, которым в зависимости от предела прочности при растяжении или при изгибе предусд1атриваются различные марки серого чугуна (табл. 100). [c.153]

    Модуль нормальной упругости серого чугуна находится в пределах 6000—17 ООО кПмм и зависит от количества и формы графита, а также от величины абсолютных значений напряжений (т. е. определенный модуль упругости может быть отнесен только в определенной величине напряжений). Чем выше прочность чугуна, тем выше относительный модуль упругости. Ударная вязкость серого чугуна (образцы без надреза) находится примерно в пределах 0,4— [c.154]

    Обычно в расплавленном литейном чугуне содержится около 0,13% серы содержание серы перед литьем можно уменьшить до 0,005%, но обычно чрезмерная десульфурнзация нежелательна. Основное достоинство десульфуризации в том, что она позволяет использовать для загрузки в печи разнообразное сырье (например, дешевый скрап вместо дорогого передельного чугуна) получать мало-сернистый ( таким образом снижается потребное количество магнийсодержащих добавок, которые также уменьшают количество получаемого шлака и, следовательно, случайных дефектов поверхности в отливках) уменьшить охлаждение снижает брак, обусловленный раковинами, и повышает механические свойства (предел прочности при растяжении для высокопрочного чугуна увеличивается на 12 и на 38% у железа с пределом нрочностп при растяжении 2200 кгс/см ). Как десульфурирующий агент карбид кальция обладает тем преимуществом, что образуется сухой гра-нулпрованны шлак со слабым сцеплением с огнеупорной футеровкой п очень ограниченно обратной отдачей серы из шлака в металл даже в сл5 чае использования кислой огнеупорной футеров си. [c.251]


Втулки чугунные материал СЧ18-36

Изготовим втулки чугунные материал СЧ18-36. Что можно сказать про материал. СЧ 18-36 – серый чугун, предел прочности на растяжение не менее 180 МПа, предел прочности при изгибе не менее 360 МПа, предел прочности при сжатии не менее 700 МПа.

Таблица1,

Механические свойства  отдельных марок серого чугуна (ГОСТ 1412 )

 

Марки чугуна

Предел прочности при растяжении σв, кГ/мм2

Предел прочности  при растяжении σ из, кГ/мм2

Твердость по Бринеллю, HB

сч

12-28

12 

28 

143—229

сч

15-32

15

32

163—229

сч

18-36

18 

36 

170—229

сч

21-40

21 

40 

170—241

сч

24-44

24

44

170—241

сч

28-48

28 

48

170-241

сч

32-52

32 

52

170—241

сч

35-56

35 

56 

197—248

сч

38-60

38 

60

197-262

Изготовим втулки чугунные материал СЧ18-36. Что можно сказать про материал. СЧ 18-36 – серый чугун, предел прочности на растяжение не менее 180 МПа, предел прочности при изгибе не менее 360 МПа, предел прочности при сжатии не менее 700 МПа.

Таблица1,

Механические свойства  отдельных марок серого чугуна (ГОСТ 1412 )

 

Марки чугуна

Предел прочности при растяжении σв, кГ/мм2

Предел прочности  при растяжении σ из, кГ/мм2

Твердость по Бринеллю, HB

сч

12-28

12 

28 

143—229

сч

15-32

15

32

163—229

сч

18-36

18 

36 

170—229

сч

21-40

21 

40 

170—241

сч

24-44

24

44

170—241

сч

28-48

28 

48

170-241

сч

32-52

32 

52

170—241

сч

35-56

35 

56 

197—248

сч

38-60

38 

60

197-262

расшифровка маркировки и ГОСТ.

Как он маркируется? Антифрикционный ВЧ. Как расшифровать СЧ10 и другие марки? Какие значения указывают первые цифры?

Металлургическая промышленность выпускает несколько классов чугуна, среди которых – ковкий, серый и высокотехнологичный. Чугун, несмотря на свою сравнительно сниженную относительно сталей температуру плавления, нашёл применение как сплав железа, поддающийся более медленному, чем ржавеющая сталь, окислению.

Как маркируется серый чугун?

Согласно ГОСТу серый чугунный состав – сплав железа с графитом, включённым в такое соединение в виде пластинок или волосков, хлопьев. Это не просто однородный раствор углерода в железе. Графит, как известно, аллотропное видоизменение угля. Структура чугуна в электронно-микроскопическом увеличении изображения тут же выдаёт графитные пластинки: графит имеет склонность к расслаиванию. Принцип графитного сплава с железом – стабильная высокоуглеродистая фаза. Содержание углерода в чугуне – свыше 2% по массе.

Интенсивность и оперативность принудительного охлаждения чугунных составов приводят к образованию ферритно-перлитных модификаций. Чем скорее рабочие примут меры к скорейшему охлаждению чугуна, тем отчётливее его перлитная составляющая, и менее заметна ферритная. Чем больше перлита, тем более твёрд, но менее пластичен чугунный сплав.

Одна из разновидностей серого чугуна – высокопрочный чугун с модифицированным составом, в который включены магний и некоторые лантаноиды, к примеру, церий (не путать с цезием).

Расшифровка СЧ означает именно серый чугун. Предел прочности в килограммах на квадратный миллиметр поверхности заготовки из такого чугуна у сплава СЧ-30, к примеру, 30 кг/мм2. Это значит, что, если превысить давление – оказать воздействие выше этого показателя, то чугун начнёт трескаться. Он раскрошится. Первые цифры в маркере указывают именно на это значение. Высокопрочные чугуны – маркер ВЧ выдаёт их свойства – годятся для изготовления станины, зубчатого колеса-шестерёнки в некоторых механизмах, не подвергающихся сверхвысоким нагрузкам.

Однако чаще для шестерёнок всё же используют высокопрочные, стойкие к стиранию стали. Расшифровать маркер СЧ10 или СЧ15 можно следующим образом: серый чугун с воздействием на разлом/крошение в 10 и 15 кг/мм2 соответственно. Чтобы превратить серый чугун в материал, обладающий антифрикционными свойствами, потребуется переплавить его в высокопрочный чугун либо, выжигая часть угля/графита из него путём вдувания воздуха, получить из него высокоуглеродистую сталь.

Серый чугунный сплав хорошо отливается. Ковать его нельзя: при перегреве он сразу плавится (делается жидким). В расплавленном состоянии он весьма текуч, из-за чего востребован литейщиками. Его используют для отливки поршней, станин, клапанов и других деталей для всевозможных машин. Но повышенная хрупкость не даёт использовать серый чугунный состав для работы на растягивание или изгиб. Процент графита и угля в сером чугуне – 2,9-3,7%. На изломе серый чугун имеет соответствующий цвет. Превышение прочности на растягивание или сгибание в 35 кг/мм2 приводит к поломке детали или комплектующей. Пониженная концентрация – ниже 2,4% углерода – сразу же приведёт к потере чугунными заготовками заявленной прочности.

Кремния в чугуне содержится 1,2-2,5%. А вот сера, из-за которой железо портится, становится хрупким, содержится лишь в количестве 1,2-1,5 промилле. Чтобы ослабить влияние сульфида железа, с которым сера вступает в реакцию для образования этого минерала, в чугун вводят марганец в количестве 0,5-1,1% по массе сплава. Фосфорная присадка – 2-3 промилле – повышает твёрдость и стойкость чугуна к истиранию, к подобному эффекту приведёт и хром.

В числе прочих включений в чугунных модификациях присутствуют следующие присадки:

  • олово – придаёт равномерную твёрдость всей толще выпускаемой детали;

  • никель и молибден делают чугун более коррозионностойким;

  • медь способствует структуризации угля в фазу графита, повышает упругость и невосприимчивость к окислению;

  • сурьма (до 0,8 промилле) структурирует кристаллическую решётку чугуна.

Кроме вышеперечисленных металлов, в серый чугун вводят титан и магний. Серый чугун даёт малую усадку после остывания, не кристаллизуется на поверхности в «раковины», устойчив к трению и образованию трещин при допустимых нагрузках. Но самым высокопрочным серым чугуном является именно перлитный СЧ.

Марки высокопрочного чугуна

ВЧ – высокопрочный чугун – обладает графитными включениями шарообразной, а не пластинчатой формы. Это придаёт ему более сплошную структуру и повышенную прочность. В зависимости от скорости охлаждения ВЧ, получают ферритный (относительно ВЧ) состав, ферритно-перлитный и перлитные сплавы. Шаровидная форма графита не способствует появлению большого количества микротрещин. ВЧ более устойчив к сгибанию и растягиванию, чем СЧ. Он менее склонен к накоплению так называемой усталости металла, не менее хорошо, чем СЧ, отливается в детали по формам, более терпим к механообработке. Выдерживает большее давление (усилие на сжатие), отчего ВЧ применяют в качестве основы для батарей и трубопроводов.

ВЧ в изготовлении подчиняется нормативам, описанным в ГОСТ 7293-85. Маркировка у этого чугуна похожая – как и у СЧ. Например, ВЧ-50 – высокопрочный чугун с усилием в 50 кг/мм2. ВЧ35 значительно менее устойчив к сдавливанию (сжатию), чем ВЧ50.

Маркировка ковкого чугуна

Ковкий чугун обладает относительной мягкостью и вязкостью. Его отливают из беловатого чугуна, затем подвергают дальнейшему термическому закаливанию. Для производства ковкого чугуна используется метод долгого отжига, в результате уголь превращается в цементит, а затем преобразуется в графит. Подобно СЧ, КЧ обладает стальной основой с включением графитных частиц, напоминающих хлопья. Образуются они при прохождении трёх последовательных стадий, благодаря которым состав нагревается до 975 градусов, затем выдерживается при 730 градусах, а затем, начиная с этой температуры, медленно охлаждается. На второй стадии цементит превращается в графитные хлопья. Последние придают ковкому чугуну больше пластичности. Все три стадии занимают более двух суток. В ковком чугуне угля содержится в среднем 2,65%, кремния – 1,3, кремнеуглерода – 3,9.

Чтобы получить черносердечный чугунный состав с хлопьевидным графитом, его подвергают графитизирующему отжигу. У белосердечного, напротив, избыток углерода удаляется путём вдувания воздуха, кислород которого, забирая на себя уголь (и выдавая угарный/углекислый газ), очищает сплав от избытка углерода. Время отливания заготовок из такого чугуна – порядка 65 часов. Достоинства белосердечного чугуна – склонность к улучшенной сварке таких конструкций, чего не скажешь о черносердечном. Особенность эта обусловлена тем, что близкая по составу к стали сердцевина отлетит при термических колебаниях с меньшей вероятностью от заготовки из такого же чугуна, к которой она приварена за один и тот же временной период эксплуатации.

Ковкий чугунный сплав хорошо режется, обладает относительно однородной структурой, не демонстрирует внутренние напряжения в отлитой заготовке. Он невосприимчив к высоким нагрузкам, меняющим направление вектора прилагаемого воздействия. КЧ обладает повышенной сопротивляемостью к разъеданию заготовок до состояния присутствия ржавого налёта. Из-за этих положительных свойств КЧ используется в машиностроительной отрасли: коробки передач, шасси, шестерёнки редукторов, рычажные детали, распред- и коленвалы, поршни ДГА, толкатели клапанов в КА двигателя.

КЧ маркируется аналогично остальным видам и разновидностям чугуна. Например, КЧ-37 обладает усилием на сжатие в 370 Н/мм2, или 370 МПа (один паскаль – один ньютон на квадратный метр). Подвиды Ф (ферритный) или П (перлитный) обладают модификациями, второй характеристикой которых считается растяжение на разрыв (удлинение). Например, КЧ3712-Ф – ферритный ковкий чугун с усилием на сжатие в 37 кг/мм2 и удлинением не менее 12% (по длине детали при попытке растянуть эту заготовку). Ферритный КЧ с ферритно-перлитной структурой выпускается как КЧ30-6, КЧ33-8, а также иные сорта: 35-10/37-12. Чисто перлитный – представлен сортами КЧ 45-7, КЧ 45-6, а также прочие (различные) модификации ковкого чугуна: 50-5/55-4/60-3/65-3/70-2/80-1,5. В первом случае, как видно, чем выше допустимое воздействие на заготовку, тем выше удлинение, во втором же – с точностью до наоборот.

КЧ нашёл своё широкое применение преимущественно в машиностроении. Заводы, выпускающие детали для машин, применяют заготовки, отлитые на основе ферритного типа. Перлитной основе же не уделяется столь пристального внимания, хотя последнее легче в отливании и разрезании. В сельскохозяйственных машинах и приспособлениях ковкий чугунный сплав на перлитной основе заменяет среднеуглеродистую сталь. Эксплуатация и технологии обработки такого чугуна находятся как бы в гармонии друг с другом – по соответствующим параметрам. Ковкий чугун легче, чем остальные виды чугунных изделий. Несмотря на разброс весовой характеристики – от нескольких сотен граммов до 150 тонн, невзирая на толщину отлитых стенок изделия, чугунный сплав лёгок в обточке, разрезании и в термодоработке. Относительная дешевизна ковкого чугунного состава по сравнению со сталью вытеснила некоторые стальные компоненты.

Дело в том, что температура плавления чугунного сплава – 1100-1300 градусов, а стали – 1300-1500, что из-за более высоких энергозатрат делает стальные изделия более дорогими в производстве. Как и сталь, ковкий чугунный сплав хорошо гасит вибрацию – он менее подвержен разрушениям, растрескиванию от неё.

Двоичное дерево декодирования SC

Контекст 1

… концепция нулевого узла скорости, предложенная в [15]. Для полярных кодов с длиной N = 2 n обычное SC-декодирование может быть выражено в виде полного бинарного дерева T n глубины n, и для лучшего понимания мы отсылаем читателей к [15]. Для полярных кодов с N = 16 и подканалами {4, 8, 12, 14, 15, 16} в качестве информационных подканалов двоичное дерево показано на рис. 3. Узел v называется узлом с нулевой скоростью, если все листовые узлы, являющиеся потомками узла v, являются замороженными битами.Например, на рис. 3 белые кружки представляют узлы с нулевой скоростью. Для кодирования этих узлов, поскольку замороженные биты обычно выбираются как нули, эти узлы могут быть непосредственно установлены как нули без каких-либо последствий. Для расшифровки …

Context 2

… как полного бинарного дерева T n глубины n и для лучшего понимания отсылаем читателей к [15]. Для полярных кодов с N = 16 и подканалами {4, 8, 12, 14, 15, 16} в качестве информационных подканалов двоичное дерево показано на рис.3. Узел v называется узлом с нулевой скоростью, если все конечные узлы, являющиеся потомками узла v, являются замороженными битами. Например, на рис. 3 белые кружки представляют узлы с нулевой скоростью. Для кодирования этих узлов, поскольку замороженные биты обычно выбираются как нули, эти узлы могут быть непосредственно установлены как нули без каких-либо последствий. Для декодирования этих узлов LLR этих узлов не помогают при декодировании информационных битов. Поэтому поляризация этих узлов…

Контекст 3

… для информационных подканалов мы используем концепцию скорости одного узла. Мы называем узел v скоростью одного узла, если все конечные узлы, являющиеся потомками узла v, являются информационными битами. На рис. 3 черные кружки представляют узлы с первой скоростью. В [15] предложено, чтобы при активации узла v со скоростью один вместо распространения LLR на его потомков мы могли напрямую принимать трудное решение относительно v и восстанавливать информационные биты в соответствующих листовых узлах. Также доказано, что решения, принимаемые этим упрощенным методом, являются …

Контекст 4

… узел v, который не является ни нулевым, ни единичным, представлен серым кружком на рис. 3, соответствующие единицы поляризации не могут быть ослаблены. Для такого узла часть его потомков — замороженные биты, а остальные — информационные биты. Между тем, замороженные биты используются для декодирования информационных битов. Таким образом, релаксация соответствующих единиц поляризации приведет к ухудшению BLER …

Context 5

… единицы поляризации, соответствующей индексу i1 и i2 на этапе i.Расслабьте блок поляризации, соответствующий индексу i1 и i2, на этапе i. конец для 18: конец для и информационный набор A = {4, 8, 12, 14, 15, 16} показан на рис. 4. Сравнивая исходную структуру кодирования на рис. 1 с упрощенной структурой кодирования на рис. 3, мы можем обнаружить, что среди 32 единиц поляризации 10 из них расслаблены, что может значительно снизить сложность кодирования и декодирования, а также задержку декодирования. Между тем, основываясь на (5) и (6), мы предварительно оцениваем производительность BLER предложенных полностью релаксированных полярных кодов с использованием приближения Гаусса.Результаты …

Исследования по кодированию и декодированию недвоичных полярных кодов над GF(2m)

Доступно онлайн 5 февраля 2022 г.

https://doi.org/10.1016/j.dcan.2022.01.005Получить права и содержание

Abstract

Двоичные полярные коды (BPC) имеют преимущества высокой эффективности и достижения пропускной способности, но страдают от большой задержки из-за декодирования списка последовательного отмены (SCL). Недвоичные полярные коды (NBPC) были исследованы для получения прироста производительности и уменьшения задержки при реализации на параллельных архитектурах для многобитового декодирования. Однако большинство существующих работ сосредоточено только на NBPC на основе матрицы Рида-Соломона и недвоичном полярном декодировании на основе вероятностной области, которым не хватает гибкой структуры и требуется большой объем вычислений в процессе декодирования, в то время как мало внимания уделяется. платят за общие недвоичные NBPC на основе ядра и методы декодирования на основе отношения логарифмического правдоподобия (LLR). В данной работе рассматривается схема НБПК с общей структурой более ГФ (2 м ). В частности, мы проводим детальное моделирование методом Монте-Карло, чтобы определить конструкцию предлагаемых NBPC.Для недвоичного полярного декодирования предлагается декодирование SCL на основе LLR для NBPC, которое может быть реализовано с недвоичными ядрами произвольного размера. Кроме того, мы предлагаем алгоритм SCL на основе идеальной поляризации (PPB-SCL), основанный на LLR, для снижения сложности декодирования за счет получения новой функции обновления метрики пути для NBPC и исключения процесса разделения пути в идеально поляризованных (т. е. высоконадежных) позициях. . Результаты моделирования показывают, что частота ошибок по битам у предложенных NBPC значительно выше, чем у BPC.Кроме того, предлагаемое декодирование PPB-SCL обеспечивает снижение сложности примерно на 40% по сравнению с декодированием SCL для NBPC.

Ключевые слова

Ключевые слова

Non-Binary Polar Code

Коэффициент вероисповедания журнала

Коэффициент запрещений

110005

Perfect Polarization Base-SCL

Сложность декодирования

Рекомендуемые статьи на основе Статьи (0)

© 2022 Chongqing University Телекоммуникации. Производство и хостинг Elsevier B.V. от имени KeAi Communications Co.Ltd.

Рекомендуемые статьи

Ссылающиеся статьи

Расшифровка неканонического распада мРНК с помощью сенсора стресса эндоплазматического ретикулума IRE1α

Культура клеток и экспериментальные реагенты

MDA-MB-231, HCC1806, KMS-27 и HCT116 Все клетки АМО-1 были получены от ATCC. Клетки U2OS WT и IRE1α KO описаны Belyy et al. 54 . Все клетки были аутентифицированы с помощью профилей коротких тандемных повторов (STR) и протестированы на отсутствие микоплазмы в течение 3 месяцев использования.Все клеточные линии культивировали в среде RPMI1640 с добавлением 10% (об./об.) эмбриональной бычьей сыворотки (FBS, Sigma), 2 мМ глутаМАКСа (Gibco) и 100 ЕД/мл пенициллина плюс 100 мкг/мл стрептомицина (Gibco).

Тапсигаргин (Sigma) использовали в концентрации 100 нМ. Соединение 4µ8C и соединение 18 растворяли в ДМСО для клеточных экспериментов и использовали в указанных концентрациях. Антитела (Ab) к IRE1α (#3294), TGOLN2 (#95649), AIM2 (#12948), актину (#5125) и GAPDH (#8884) от Cell Signaling Technology.CD59 (#133707), GBA (#125065), BCAM (#134110), HIP1 (#181238), TLR2 (#68159), SIX2 (#111827), SUOX (#129094) и BMP4 (#124715) от Abcam . BLOC1S1 (#19687-1-AP), OAS2 (#19279-1-AP), ALDh2A3 (#25167-1-AP), GPC1 (#16700-1-AP) от ProteinTech. Антитела pIRE1 и XBP1s были получены в Genentech. Вторичные антитела (кроличьи № 711-035-152 и мышиные № 715-035-150) были получены от Jackson ImmunoResearch Laboratories.

Нокаут CRISPR/Cas9: направляющие последовательности РНК и методика IRE1, нацеленный на гРНК (см. ниже), клонирован в вектор pLKO.Трансфекцию проводили с использованием Lipofectamine 3000 в соответствии с протоколом производителя, а трансформанты отбирали с помощью ПЦР на геномной ДНК для обнаружения делеций. Затем секвенировали правильные клоны.

IRE1 α KO cl.1-2 пара гРНК: CTTGTTGTTTGTGTCAACGC & TCTGCTTCCAAGCGTATAC.

RNAseq/GROseq

И RNAseq, и GROseq проводили на клетках WT и IRE1 α KO MDA-MB-231. Для каждой RNAseq и GROseq было четыре экспериментальных условия (WT и IRE1 α KO, обработанные Tg или контрольным носителем (ДМСО) в течение 8 часов с тремя биологическими повторами ( n  = 3) для каждого условия.

Для RNAseq РНК экстрагировали с использованием набора RNeasy (Qiagen #74104), выполняя расщепление ДНК на колонке в течение 15 мин. Концентрацию образцов РНК определяли с использованием NanoDrop 8000 (Thermo Scientific), а целостность РНК анализировали с помощью анализатора фрагментов (Advanced Analytical Technologies). Приблизительно 500 нг общей РНК использовали в качестве исходных данных для подготовки библиотеки с использованием набора для подготовки образцов РНК TruSeq v2 (Illumina).

Для GROseq клетки предварительно обрабатывали 5-этинилуридином (EU) в течение 30  мин перед фракционированием ядер с использованием набора Sigma (#NUC101), а затем с помощью протокола Invitrogen Click-iT™ Nascent RNA Capture Kit для экстракции растущего транскрипта (# C10365).Затем РНК экстрагировали с использованием набора RNeasy (Qiagen #74104), выполняя расщепление ДНК на колонке в течение 15 минут, а затем подвергали обратной транскрипции с помощью Superscript VILO IV Master Mix от Invitrogen. Библиотеки готовили в соответствии с протоколом из набора для подготовки библиотеки РНК NEBNext® Ultra™ II для Illumina® (NEB #E7770S) и указателей (NEB #E7335S и #E7500S).

Размер библиотек для RNAseq и GROseq был подтвержден с использованием 4200 TapeStation и ленты для скрининга High Sensitivity D1K (Agilent Technologies), а их концентрация была определена методом на основе количественной ПЦР с использованием набора для количественного определения библиотеки (KAPA).Библиотеки мультиплексировали, а затем секвенировали на Illumina HiSeq2500 (Illumina) для получения 30 M ридов с одним концом из 50 пар оснований.

Комбинированный анализ RNAseq-GROseq

Функция DGEList из пакета edgeR (версия 3.24.3) в R (версия 3.5.1) была применена к подсчетам из наборов данных GRO-seq и RNA-seq, объединенных в один набор данных . Гены сохраняли, если их количество на миллион превышало 1,0 не менее чем в трех образцах, и к полученной матрице количества применяли функцию calcNormFactors.Отрицательные биномиальные дисперсии вычислялись с использованием функции AssessmentDisp с параметром устойчивости, установленным в значение true. Наблюдения были логарифмически преобразованы и взвешены с использованием функции voomWithQualityWeights из пакета limma (версия 3. 38.3) в R. Статистические данные были рассчитаны с использованием функций lmFit, converts.fit и eBayes для контраста между выражением GRO-seq диких образцы типа, обработанные Tg через 8 часов по сравнению с ДМСО, минус экспрессия РНК-seq образцов дикого типа, обработанных Tg через 8 часов по сравнению с ДМСО.

Чтобы идентифицировать IRE1α-специфические RIDD-мишени, мы сравнили дифференциальную экспрессию генов в клетках WT и KO после 8-часовой обработки Tg: Log 2 кратное изменение (Log 2 (FC)), средняя экспрессия, p — значения и значения частоты ложных открытий (FDR) были рассчитаны для каждого белка, кодирующего гены, сравнивая начальную временную точку ДМСО с 8 часами после обработки Tg в условиях WT и IRE1 α KO для наборов данных RNAseq и GROseq. Log 2 (FC) в наборе данных RNAseq WT, для которого значение p и значение FDR были выше 0.05 были удалены. Различие Log 2 (FC) между наборами данных RNAseq WT и IRE1 α KO (Log 2 (KO-WT)) ниже 0,5 было удалено, а также были удалены гены со средними значениями экспрессии ниже 1. Наконец, различия Log 2 (FC) между RNAseq и GROseq WT (Log 2 (WTrna-WTgro)), опускающиеся ниже -0,3, были удалены. Результирующий список генов состоит из 54 записей.

Анализ сигнальной последовательности

Для каждого транскрипта мРНК, выбранного в качестве репрезентативного кандидата для гена, мы определили соответствующую последовательность белка, запустив GMAP (версия 2019-12-01) 73 , выровняв последовательность с самой собой, используя -g флаг и извлечение полноразмерной трансляции белка с флагами «-P-F».Затем мы запустили программу signalp (версия 3.0) 74 на последовательности белка с флагом «-t euk», что дало предсказание сигнальной последовательности и вероятности для сигнального пептида, сигнального якоря и сайта расщепления. Каждая мРНК также была проверена в Uniprot для дополнительной проверки.

Иммунофлуоресцентное окрашивание белков с РНК гибридизацией in situ (ISH) цитоспин

IRE1α Клетки WT и KO MDA-MB-231 готовили следующим образом: клетки выращивали на чашках диаметром 10 см, обрабатывали Tg (100 нМ) и собранные в моменты времени 0, 6 или 24 часа. Клетки подсчитывали с использованием ViaCell и ресуспендировали в PBS при концентрации 1 × 10 ×/мл. Затем клетки центрифугировали при 500 ×  g в течение 5 мин при комнатной температуре (КТ) и почти полностью удаляли PBS, не нарушая осадок. Осадки ресуспендировали путем осторожного пипетирования в соответствующий объем NBF (10% об./об. нейтрального забуференного формалина) для получения концентрации клеток 1 × 10 6 /мл и инкубировали в течение 30 мин при 37°С. Затем образцы центрифугировали при 500 ×  g в течение 5 минут при комнатной температуре, удаляли NBF и дважды промывали клетки в PBS.После последней промывки PBS клетки ресуспендировали в ледяном 70% растворе этанола в концентрации 1 × 10 6 /мл и хранили при 4 °C до использования для анализа (максимум 1 месяц). Образцы центрифугировали при 800 RCF в течение 10 мин и извлекали предметные стекла из набора для цитопрепа. Предметные стекла сушили на воздухе в течение 20 минут при комнатной температуре и обезвоживали в 50, 70 и 100% этаноле при подготовке к окрашиванию.

Автоматизированные процедуры

Автоматизированный цитоспиновый ISH — это модифицированный одиночный протокол ISH от Advanced Cell Diagnostics RNAScope 2.5 LS Reagent Kit-Red User Manual (ACD, UM-322150 RevA), выполненное с использованием системы Leica Bond-RX. Этапы предварительной обработки были скорректированы для поддержания оптимальной морфологии образцов цитоспина. Процедура флуоресцентного ISH была изменена по сравнению с протоколом ACD на этапах амплификации.

Предварительная обработка образцов

После цитоспинирования предметные стекла извлекали из 100% этанола и сушили в течение 30 мин в печи при 37 °C. Предметные стекла были помечены протоколом ACD2.5 Red Rev B (без этапа контрастного окрашивания) и помещены в лоток штатива для предметных стекол Bond RX для обработки.Выберите «замороженную задержку слайда» в качестве протокола подготовки, чтобы приспособиться к ночной задержке. Поиск антигена проводили с помощью *ACD HIER в течение 15 минут с ER2 при 88 °C (Bond Epitope Retrieval Solution 2; Leica Cat # AR9640). Стадия ферментативного расщепления была пропущена, чтобы избежать чрезмерного переваривания образца. Активность эндогенной пероксидазы подавляли перекисью водорода RNAScope 2,5 LS в течение 10 минут при комнатной температуре и дважды промывали промывочным буфером 1X Bond (концентрат Leica 10X, кат. № AR9590). Этап гашения перекисью был повторно добавлен в протокол гибридизации в качестве обходного пути, поскольку этапы ферментативной обработки и гашения были связаны в автоматизированной программе.Таким образом, отмена обработки ферментом также приводит к отмене стадии гашения. В этом обходном пути нет необходимости, если этап ферментативного расщепления не исключен.

Двойная флуоресцентная процедура ISH/ICC

Двойная флуоресцентная цитоспиновая процедура ISH/ICC (иммуноцитохимия) 75 представляет собой модифицированный протокол окрашивания одиночного хромогенного детектирования RNAScope LS 2.5 Red (322150-USM) с использованием набора реагентов RNAScope 2.5 LS (ACD, 322150). После предварительной обработки образца были выполнены этапы гибридизации и амплификации в соответствии с RNAScope LS2.5 (ACD, UM-322150 RevA) (см. Дополнительную таблицу 8). Зонды гибридизовали в течение 2 ч при 42°С. Предметные стекла промывали промывочным буфером 1X Bond (концентрат Leica 10X, AR9590) при 42 °C 3 раза (0, 1, 5 мин) с последующими восемью промывками промывочным буфером 1X Bond по 0 мин каждое. Образцы обрабатывали только до конца этапа Амплификации 4 (*ACD Amp4) с последующей промывкой. Обнаружение ISH было завершено с использованием Opal-570 (1: 1500) в 1-кратном буфере для амплификации (PerkinElmer, NEL794001KT) 1 и 10 минут каждый при комнатной температуре.Предметные стекла промывали промывочным раствором 1× Bond 3 раза по 0 мин каждый, а затем еще 5 раз по 1 мин при комнатной температуре. Затем предметные стекла дважды промывали деионизированной водой и продолжали процедуру ICC.

После завершения обнаружения ISH предметные стекла снова обрабатывали перекисью водорода RNAScope LS2. 5 для подавления эндогенной пероксидазы в течение 10 минут при комнатной температуре и три раза промывали промывочным буфером 1× Bond. Предметные стекла инкубировали с блокирующим TNB (0,1 М трис-HCl, рН 7,5, 0,15 М NaCl, 0,5% блокирующего реагента PerkinElmer, FP1012) в течение 30 мин при комнатной температуре.Первичное антитело инкубировали 60 мин при комнатной температуре. Затем предметные стекла промывали 3 раза открытым промывочным буфером 1× Bond. Конъюгированное с HRP вторичное антитело добавляли на 30 мин при комнатной температуре, а затем выполняли шесть открытых промывок промывочным раствором 1× Bond. Заключительный этап детекции проводили с красителем PerkinElmer Opal-690 (1:1500) в 1× буфере для амплификации, инкубировали в течение 30 мин при комнатной температуре. Избыток красителя удаляли восемью открытыми промывками промывочным раствором Bond. Спектральное контрастное окрашивание DAPI (PerkinElmer. FP1490) проводили в течение 5 минут при комнатной температуре.Избыток DAPI смывают пятью промывками деионизированной водой. Наконец, слайды были покрыты покровным стеклом с реагентом против выцветания Prolong Gold (Life Technology, номер по каталогу P36930) или с постоянной средой для монтажа Tissue Tek Mounting Medium (Sakura, номер по каталогу 6419) на основе ксилола.

RT-qPCR

РНК экстрагировали с использованием набора RNeasy Plus (Qiagen #74134). Равные количества РНК подвергали обратной транскрипции и амплифицировали с использованием набора TaqMan™ RNA-to-CT™ 1-Step Kit (Applied Biosystems № 4392938) на системе ПЦР в реальном времени ABI QuantStudio 7 Flex.Значения дельта-дельта C T рассчитывали путем соотнесения каждого отдельного значения C T с его внутренним контролем GAPDH. TaqMan праймеры для XBP1u (# Hs02856596_m1), XBP1s (# Hs03929085_g1), DGAT2 (# Hs01045913_m1), BLOC1S1 (# Hs00155241_m1), CD59 (# Hs00174141_m1) и TNFAIP8L1 (# Hs00537038_m1) и GAPDH (# Hs02758991_g1) были от технологии Life . Дополнительные пары праймеров, используемые для количественной ПЦР в экспериментах по спасению клеток, были заказаны в IDT: TNFAIP8L1 (#Hs. PT.58.39992641), SNN (#Hs.PT.58.28146300), SIX2 (# Hs.PT.58.40614621), GAPDH (# Hs.PT.39a.22214836) и специально разработанные (см. Дополнительную таблицу 9).

Конструкции РНК Т7

Мы подготовили транскрипты РНК Т7 из матриц кДНК, выбранных на основе функциональной значимости в сочетании с оптимальной длиной для рибонуклеолитической реакции (~ 0,5–2  т.п.н.). конструкции кДНК, кодирующие XBP1 (#HG10751-UT), DGAT2 (#HG14114-G), CD59 (#HG12474-UT), TGOLN2 (#HG17252-UT), SIX2 (#HG21116-UT), CFAP45 (#HG22377-UT) , MFAP2 (#HG16644-UT), PIGQ (#HG22757-UT), BMP4 (#HG10609-UT), BCAM (#HG10238-UT), SNN (#HG23279-U), GBA (#HG12038-UT), WT1 (#HG12282-UT), CCDC69 (#HG27177-U), AIM2(#HG11654-UT) были от Sino Biological, а BLOC1S1 (#RC224412), TNFAIP8L1 (#RC203912) от Origene.кДНК амплифицировали с использованием прямых праймеров T7, а затем транскрибировали in vitro с использованием набора для быстрого синтеза РНК HiScribe™ T7 Quick High Yield от NEB (#E2050S).

Мутации РНК T7 были сконструированы с использованием перекрывающейся ПЦР с последующим рестрикционным расщеплением, а конечные фрагменты были очищены из агарозного геля (набор для восстановления ДНК Zymoclean Gel #D4001).

Очистка белков и разделение фосфорилированных фракций IRE1α

IRE1α KR 0P и 3P были произведены компанией Accelagen и собственными силами: IRE1α KR (G547-L977) был экспрессирован как N-концевые His 6 -меченые слитые белки в клетках SF9 с сайтом расщепления протеазы TEV из внутриклеточного вектора экспрессии BEVS.Осадок клеток ресуспендировали в лизирующем буфере, содержащем 50 мМ HEPES pH 8,0, 300 мМ NaCl, 10% глицерин, 1 мМ MgCl 2 , 1:1000 бензоназу, таблетки PI без ЭДТА (Roche), 1 мМ TCEP и 5 мМ. имидазол. Образец лизировали ультразвуком, центрифугировали при 12000× g в течение 45 минут, а супернатант фильтровали через фильтр Nalgene 0,8 мкм. Осветленный супернатант связывали с гранулами Ni-NTA Superflow (Qiagen) гравитационной фильтрацией. Гранулы промывали буфером для лизиса с добавлением 15 мМ имидазола с последующей элюцией белка в буфере для лизиса, содержащим 300 мМ имидазола.Элюат инкубировали с протеазой TEV в течение ночи при 4 °C. Образец белка IRE1α KR разводили 1:10 в 50 мМ HEPES pH 7,5, 50 мМ NaCl, 1 мМ TCEP, а затем загружали в предварительно заполненную колонку Q-HP объемом 5 мл (GE-Healthcare). Разделение нефосфорилированного и фосфорилированного IRE1α KR было достигнуто путем элюирования белка с очень небольшим градиентом (50-300 мМ NaCl при 70CV). Полностью фосфорилированную фракцию (MW + 240 по данным ЖХ-МС) собирали отдельно, а остальные белковые фракции объединяли и инкубировали с лямбда-фосфатазой в течение одного часа при комнатной температуре.Дефосфорилирование было подтверждено ЖХ-МС. Затем нефосфорилированные и фосфорилированные образцы концентрировали и загружали отдельно на колонку HiLoad 16/600 Superdex 200 SEC (GE Healthcare), уравновешенную 25 мМ HEPES, pH 7,5, 250 мМ NaCl, 1 мМ TCEP, 10% глицерина. IRE1α элюируется в виде мономера.

Мутанты S724A, S726A, S729A, S724A-S726A, S724A-S729A, S726A-S729A и R887A были получены собственными силами в соответствии с описанной выше процедурой.

Картирование сайтов фосфорилирования выполняли с помощью анализа ЖХ-МС/МС после расщепления протеазой (см. Дополнительную таблицу 10).

Фосфорилирование мутантов IRE1α KR и петли активации

Мутанты IRE1α KR S/A и R887A подвергались автофосфорилированию в присутствии 2 мМ АТФ и 10 мМ MgCl 2 в течение одного часа при комнатной температуре. Образец очищали от АДФ эксклюзионной хроматографией (SEC).

Мутант S726A-S729A не был способен к аутофосфорилированию и вместо этого был инкубирован с pIRE1α LKR (линкер-киназа-РНКаза, остатки Q470-L977) в соотношении 1:40 мас./мас., 2 мМ АТФ и 20 мМ MgCl 2 .Конечные фосфорилированные белки очищали от pIRE1α LKR и остаточных нуклеотидов с помощью SEC.

Анализ расщепления РНК

Один микрограмм РНК T7 расщепляли при комнатной температуре с помощью 1 мкг рекомбинантного белка IRE1α KR человека (конечная концентрация ~0,8 мкМ) в течение 15 мин в буфере для расщепления РНК (HEPES pH 7,5, 20 мМ; K ацетат, 50 мМ). ; ацетат Mg 1  мМ; TritonX-100 0,05% (об./об.)). Общий объем реакции составляет 25 мкл. Затем расщепление дополняли равным объемом формамида и нагревали при 70 °С в течение 10 минут для линеаризации РНК.После линеаризации смесь сразу помещали на лед на 5 мин, а затем 20 мкл прогоняли в 3% агарозном геле при 160 В в течение 50 мин при 4°С. Если использовались ингибиторы (5 мкМ), их инкубировали с РНК в течение 40 минут на льду перед расщеплением РНК. Гели визуализировали на приборе BioRad Molecular Imager ChemiDoc ZRS+.

Секвенирование фрагментов РНК

Два микрограмма РНК T7 (TNFAIP8L1, DGAT2) используются для расщепления IRE1α KR-3P человека, как описано выше. Полосы РНК экстрагируют из геля с использованием набора Zymoclean Gel RNA Recovery Kit (Zymo Research #R1011).Затем выделенную РНК лигировали с помощью лигазы RtcB (NEB # M0458S) в олигонуклеотид 3′-адаптера, специально разработанный и заказанный в IDT (caagcagaagacggcatacgagatCGTGAT), следуя ручному протоколу. Затем лигированную РНК подвергали обратной транскрипции с использованием системы синтеза первой нити SuperScript™ IV (Invitrogen #180) и праймера, специфичного для 3′-адаптера (ATCACGatctcgtatgccg). Затем кДНК амплифицировали с использованием специфического прямого праймера DGAT2 (gggGCATGCATGAAGACCCTCATAGCCG) или TNFAIP8L1 (gggGCATGCATGGACACCTTCAGCACCAAG), содержащего сайт фермента рестрикции SphI, и обычного обратного праймера, содержащего сайт фермента рестрикции EcoRI (gggGAATTCATCACGatctcgtatgccg).Продукт ПЦР затем расщепляли с помощью SphI и EcoRI перед клонированием в вектор pGEM®-T Easy (Promega #A1360). Затем полученные плазмиды трансфицировали в компетентные клетки (Zymo Mix & Go! Competent Cells Zymo 10B #T3019), высевали на чашку диаметром 10 см и оставляли при 37°С на ночь. На следующий день отдельные колонии собирают и выращивают в течение ночи на 96-луночных планшетах, предназначенных для роста бактерий (Thomson Instrument Company #951657). Наконец, ДНК извлекают из отдельных лунок с помощью набора Zyppy-96 Well Plasmid Miniprep Kit (Zymo Research # D4042) и отправляют на секвенирование SANGER (см. Дополнительные данные 1).

Анализ активности РНКазы (кинетическая флуоресценция)

Меченый 5′-карбоксифлуоресцеином (FAM) и 3′-тушителем черных дыр (BHQ) мини-субстрат с одним стеблем и петлей, содержащий последовательность XBP1 (5’FAM-CAUGUCCGCAGGCGCAUG-3 ‘BHQ) использовали в качестве субстрата для расщепления с помощью IRE1α KR (G547-L977) в 20 мМ HEPES pH 7,5, 50 мМ ацетата калия, 1 мМ ацетата магния, 1 мМ дитиотреитола, 0,05% об. /об. TritonX-100. 10 нМ белка инкубировали с различными концентрациями РНК-субстрата (серия двукратных разведений от 3000 до 5.86 нМ). Расщепление РНК измеряли кинетически в течение часа при комнатной температуре по увеличению флуоресценции. Заключительную реакцию проводили в 20 мкл в 384-луночных планшетах. Образцы запускали в двух повторностях. Скорость реакции измеряли как наклон линейно возрастающего сигнала флуоресценции с течением времени в относительных единицах флуоресценции (ОЕФ)/с и наносили на график как функцию концентрации РНК-субстрата. Кинетика Михаэлиса-Ментен была подогнана с использованием Prism 1.7, а результирующие константы Vmax и Km были зарегистрированы.

Иммуноблот-анализ

Клетки лизировали в 1× буфере RIPA (Millipore), дополненном свежими ингибиторами протеазы и фосфатазы (Invitrogen #78440), очищали центрифугированием при 12000 ×  g в течение 15 мин и анализировали с помощью анализа белка BCA Термофишер Научный № 23227). Загружали равные количества белка, разделяли с помощью SDS-PAGE, электропереносили на нитроцеллюлозные мембраны с помощью системы iBLOT2 (Invitrogen) и блокировали в 5% растворе обезжиренного молока в течение 30 мин. Мембраны зондировали необходимыми антителами. Сигнал был обнаружен с использованием соответствующих вторичных антител, конъюгированных с пероксидазой хрена (HRP). Все первичные антитела использовали в разведении 1:000 и гибридизовали в течение ночи при 4 °C с последующей двухчасовой инкубацией со вторичными антителами, конъюгированными с пероксидазой хрена (HRP), в разведении 1:10000.

Анализ перекрестного связывания

In vitro: 1 мкг рекомбинантного белка IRE1-KR подвергали поперечному сшиванию в 25 мкл конечного объема буфера для расщепления РНК, содержащего 1 мкл сшивающего агента дисукцинимидилсуберата (DSS, Thermo Fisher Scientific) на 6.25 мМ (конечная концентрация 250 мкМ) в течение 1 ч на льду. Для экспериментов с повторяющимися соединениями-ингибиторами и активаторами, IRE1α KR и низкомолекулярным соединением (5 мкМ) сначала предварительно инкубировали вместе на льду в течение 40 минут. Реакцию гасили, используя 1 мкл 1 М раствора ТРИС с рН 7,5 в течение 15 мин на льду. Затем реакционную смесь разбавляли в 500 мкл буфера для расщепления РНК, и 13 мкл его использовали для анализа на геле SDS-PAGE (что соответствует ~ 25 мкг белка). к нитроцеллюлозным мембранам с помощью системы iBLOT2 (Invitrogen) и блокировали в 5% растворе обезжиренного молока.Наконец, его инкубировали в течение ночи при 4 °C с антителом IRE1α (Cell Signaling, #3294S) в разведении 1:1000 с последующей двухчасовой инкубацией со вторичными антителами, конъюгированными с пероксидазой хрена (HRP), в разведении 1:10000.

In vivo: клетки лизировали в 100 мкл 1% Triton X-100 в PBS с добавлением свежих ингибиторов протеазы и фосфатазы (Invitrogen #78440), инкубировали на льду в течение 10 мин и очищали центрифугированием при 12 000×  г в течение 15 мин. Семьдесят микролитров лизата сшивали 0.7 мкл сшивающего агента DSS (Thermo Fisher Scientific) (конечная концентрация 250 мкМ) на 1 ч при комнатной температуре. Реакцию гасили, используя 3,5 мкл 1 М раствора ТРИС с рН 7,5 в течение 15 мин при комнатной температуре. Концентрацию белка определяли с помощью анализа BCA, и по меньшей мере 25 мкг использовали для анализа на геле SDS-PAGE для вестерн-блоттинга.

Гель-фракционирование

Сто микрограммов IRE1-KR-3P сшивали с помощью DSS в течение 30 мин на льду. Затем реакционную смесь наносили на гель Invitrogen 4–16% NativePAGE при 4 °C в течение 4  часов при 100 В.Затем гель разрезали на куски в местах, соответствующих мономерным, димерным и олигомерным фракциям. Затем гелевые фракции помещали в 100 мкл буфера для расщепления РНК, содержащего 4 мкг транскрипта РНК Т7, для переваривания в течение ночи при 4°С. Наконец, использовали 10 мкл реакционной смеси и запускали ее на 3% агарозном геле для визуализации.

Спасение клеточного IRE1α

Клеточные линии MDA-MB-231 или HCC1806 shIRE1α трансфицировали 2  ​​т.п.н., управляемой промотором IRE1α – устойчивым к shIRE1α – меченым GFP/His IRE1α WT или мутантным R887A – устойчивым к неомицину конструктом, с использованием Mirus TransIT-X2 система доставки на шестилуночных планшетах. Через 24 часа клетки переносили в индивидуальные колбы Т75 на 4 дня. Среду меняли, и клетки отбирали с использованием генетицина в конечной концентрации 1,5 мг/мл в течение примерно 10 дней, затем FACS сортировали на GFP-положительные клетки.

Анализ жизнеспособности

В общей сложности 4000 клеток высевали в четырех повторностях на 96-луночные планшеты Corning либо со стандартным плоским прозрачным дном, либо с ULA (#7007). При высеве клетки обрабатывали конечной концентрацией доксициклина 0,4 мкг/мл (Clonetech) в общем объеме 200 мкл. Спустя семь дней из каждой чашки очень осторожно отбирали по 100 мкл среды, не повреждая сфероиды из чашки ULA.Затем жизнеспособность клеток оценивали с помощью CellTiter-Glo 3D, добавляя 100 мкл буфера (Promega #G9683) в каждую лунку и несколько раз пипетируя вверх и вниз, и измеряя в люминесцентном ридере (Envision; PerkinElmer). Данные, представленные как относительная жизнеспособность после обработки Dox, рассчитываются из средних значений четырех повторов образцов, где жизнеспособность клеток, обработанных Dox, делится на жизнеспособность необработанных клеток (отношение) и нормализуется к средней жизнеспособности 2D.

Анализ TCGA

Данные секвенирования РНК были взяты из 635 нормальных образцов и 6731 образца опухоли из 20 типов тканей в TCGA.Показатели RIDD и RIDDLE рассчитывали, взяв средний Z-показатель для сигнатурных генов. Показатели RIDD рассчитывали, взяв средний Z-показатель для генов: BLOC1S1 (Entrez Gene ID 2647), PIGQ (9091), TGOLN2 (10618), DGAT2 (84649), WT1 (7490), GBA (2629), CD59 ( 966) и BMP4 (652). Показатели RIDDLE рассчитывали, взяв средний Z-показатель для генов: BCAM (Entrez Gene ID 4059), CCDC69 (26112), MFAP2 (4237), SNN (8303), SIX2 (10736), AIM2 (9447), OAS2 ( 4939), CFAP45 (25790) и TNFAIP8L1 (126282).Данные о выживаемости образцов TCGA были получены из архива GDC Legacy Национального института рака по адресу http://portal.gdc.cancer.gov/legacy-archive путем извлечения 225 файлов с клиническими данными в формате Biotab. Цензурированную справа общую выживаемость определяли из полей, помеченных как «days_to_death», «death_days_to», «days_to_last_followup», «last_contact_days_to» и «vital_status», и сопоставляли с данными РНК-seq по штрих-коду пациента, чтобы получить данные о выживаемости на 7283 ( 98,9\%) из 7366 образцов. Для каждого нормального и опухолевого типа заболевания пациенты были разделены на две примерно равные группы в зависимости от того, была ли их оценка по шкале RIDD или RIDDLE выше или ниже медианы для данного типа заболевания. Модель Кокса была подобрана с использованием функции coxph из пакета выживания (версия 2.44-1.1) в R (версия 3.5.1). P -значения были получены путем применения сводной функции к модели Кокса. Кривые выживания были сгенерированы с использованием функции plot в R для объекта, созданного функцией survfit.Раковые опухоли, демонстрирующие значительно различную выживаемость ( p  < 0,01), были проиллюстрированы на рис. S6.

Статистика и воспроизводимость

Все значения представлены как средние (SEM) по крайней мере с двумя независимыми биологическими повторами и по крайней мере с двумя техническими повторами. Статистический анализ результатов проводили с помощью непарного, двустороннего теста t или двустороннего дисперсионного анализа. Значение P ≤0,05 считалось значимым и обозначалось * P  ≤ 0.05; ** P  ≤ 0,01. Все статистические анализы проводились с использованием GraphPad Prism 9 (GraphPad Software, Inc.). Анализы расщепления РНК и вестерн-блоты были повторены независимо друг от друга не менее 3 раз с аналогичными результатами.

Сводка отчета

Дополнительную информацию о дизайне исследования можно найти в Сводке отчета об исследовании природы, связанной с этой статьей.

Расшифровка массивного генома сосны обыкновенной с использованием гаплоидной ДНК и новых стратегий сборки | Genome Biology

  • Farjon A: Всемирный контрольный список и библиография хвойных.2001, Ричмонд: Kew Publishing, 2

    . Google ученый

  • Фархон А: Естественная история хвойных деревьев. 2008, Портленд, Орегон: Timber Press

    Google ученый

  • Мартинес-Гарсия П.Дж., Стивенс К., Вегжин Дж., Лихти Дж., Крепо М., Лэнгли С., Нил Д.: Комбинация алгоритмов многоточечного максимального правдоподобия (MML) и регрессионного картирования для построения карты генетического сцепления высокой плотности для лоблолли сосна ( Pinus taeda L.). Генетика деревьев и геномы. 2013, 9: 1529-10.1007/с11295-013-0646-4.

    Артикул Google ученый

  • Zapata-Valenzuela J, Isik F, Maltecca C, Wegrzyn J, Neale D, McKeand S, Whetten R: Маркеры SNP отслеживают семейные связи в клонированной популяции Pinus taeda — перспективы геномной селекции. Генетика деревьев и геномы. 2012, 8: 1307-1318. 10.1007/с11295-012-0516-5.

    Артикул Google ученый

  • Нил Д., Лэнгли С., Зальцберг С., Вегжин Дж.: Открытый доступ к геномам деревьев: путь к лучшему лесу. Геном биол. 2013, 14: 120-10.1186/gb-2013-14-10-r120.

    ПабМед ПабМед Центральный Статья Google ученый

  • Бирол И., Рэймонд А., Джекман С.Д., Плезанс С., Купе Р., Тейлор Г.А., Сент-Юэн М.М., Килинг С.И., Бренд Д., Вандервалк Б.П., Кирк Х., Пандох П., Мур Р.А., Чжао Ю.Дж., Мангалл А.Дж., Jaquish B, Yanchuk A, Ritland C, Boyle B, Bousquet J, Ritland K, MacKay J, Bohlmann J, Jones SJM: Сборка 20-гигабитного генома белой ели ( Picea glauca ) из данных полногеномного дробовика.Биоинформатика. 2013, 29: 1492-1497. 10.1093/биоинформатика/btt178.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Зимин А., Стивенс К., Крепо М., Хольц-Моррис А., Кораблайн М., Марсе Г., Пуйу Д., Робертс М., Вегжин Дж., де Йонг П., Нил Д., Зальцберг С., Йорк Дж., Лэнгли С.: секвенирование и сборка генома сосны лоблоловой размером 22 Гб. Генетика. 2014, 196: 875-890. 10.1534/генетика.113.159715.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Зимин А., Марэ Г., Пуйу Д., Робертс М., Зальцберг С., Йорк Дж.: Сборщик генома MaSuRCA. Биоинформатика. 2013, 29: 2669-2677. 10.1093/биоинформатика/btt476.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith HO, Yandell M, Evans CA, Holt RA, Gocayne JD, Amanatides P, Ballew RM, Huson DH, Wortman JR, Zhang Q, Kodira CD, Zheng XQH, Chen L, Skupski M, Subramanian G, Thomas PD, Zhang JH, Miklos GLG, Nelson C, Broder S, Clark AG, Nadeau C, McKusick VA, Zinder N: Последовательность генома человека .Наука. 2001, 291: 1304-1351. 10.1126/науч. 1058040.

    ПабМед КАС Статья Google ученый

  • Майерс Э.: На пути к упрощению и точной формулировке сборки фрагментов. J Компьютерная биология. 1995, 2: 275-290. 10.1089/см.1995.2.275.

    ПабМед КАС Статья Google ученый

  • Певзнер П.А.: Секвенирование ДНК с 1 кортежем: компьютерный анализ. J Biomol Struct Dyn.1989, 7: 63-73.

    ПабМед КАС Google ученый

  • Ли Р.К., Фань В., Тянь Г., Чжу Х.М., Хе Л., Цай Дж., Хуан К.Ф., Цай К.Л., Ли Б., Бай Ю.К., Чжан Ч.Х., Чжан Ю.П., Ван В., Ли Дж., Вэй Ф.В., Ли H, Jian M, Li JW, Zhang ZL, Nielsen R, Li DW, Gu WJ, Yang ZT, Xuan ZL, Ryder OA, Leung FCC, Zhou Y, Cao JJ, Sun X, Fu YG: Последовательность и de novo сборка генома гигантской панды. Природа. 2010, 463: 311-317. 10.1038/природа08696.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Миллер Дж. Р., Делчер А. Л., Корен С., Вентер Э., Валенц Б. П., Браунли А., Джонсон Дж., Ли К., Мобарри С., Саттон Г.: Агрессивная сборка ридов пиросеквенирования с помощниками.Биоинформатика. 2008, 24: 2818-2824. 10.1093/биоинформатика/btn548.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Пунта М., Коггилл П.С., Эберхардт Р.Ю., Мистри Дж., Тейт Дж., Бурснелл С., Панг Н., Форслунд К., Церик Г., Клементс Дж., Хегер А., Холм Л., Зоннхаммер Э.Л., Эдди С.Р., Бейтман А., Финн RD: База данных семейств белков Pfam. Нуклеиновые Кислоты Res. 2012, 40: Д290-Д301. 10.1093/нар/гкр1065.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Парра Г. , Брэднам К., Корф И.: CEGMA: конвейер для точного аннотирования основных генов в геномах эукариот.Биоинформатика. 2007, 23: 1061-1067. 10.1093/биоинформатика/btm071.

    ПабМед КАС Статья Google ученый

  • Кэмпбелл М.С., Лоу М., Холт С., Стейн Дж.К., Моге Г.Д., Хуфнагель Д.Э., Лей Дж., Ачаванантакун Р., Цзяо Д., Лоуренс С.Дж., Уэр Д., Шиу С.Х., Чайлдс К.Л., Сунь И., Цзян Н., Янделл M: MAKER-P: набор инструментов для быстрого создания, управления и контроля качества аннотаций генома растений. Завод Физиол. 2014, 164: 513-524. 10.1104/стр.113.230144.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Wegrzyn JL, Liechty JD, Stevens KA, Wu LS, Loopstra CA, Vasquez-Gross HA, Dougherty WM, Lin BY, Zieve JJ, Martinez-Garcia PJ, Holt C, Yandell M, Зимин AV, Yorke JA, Crepeau MW, Puiu D, Salzberg SL, de Jong PJ, Mockaitis K, Main D, Langley CH, Neale DB: Уникальные особенности мегагенома сосны лоблолли ( Pinus taeda L. ), выявленные посредством аннотации последовательности.Генетика. 2014, 196: 891-909. 10.1534/генетика.113.159996.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Goodstein DM, Shu SQ, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, Rokhsar DS: Phytozome: сравнительная платформа для геномики зеленых растений. Нуклеиновые Кислоты Res. 2012, 40: Д1178-Д1186. 10.1093/нар/гкр944.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Проект генома амбореллы: геном амбореллы и эволюция цветковых растений.Наука. 2013, 342: 1467-

    Статья Google ученый

  • Enright AJ, Van Dongen S, Ouzounis CA: Эффективный алгоритм для крупномасштабного обнаружения белковых семейств. Нуклеиновые Кислоты Res. 2002, 30: 1575-1584. 10.1093/нар/30.7.1575.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Гловацкий С., Мациошек В.К., Кононович А.К.: R-белки как основы врожденного иммунитета растений.Cell Мол Биол Летт. 2011, 16: 1-24. 10.2478/s11658-010-0024-2.

    ПабМед КАС Статья Google ученый

  • Dao TTH, Linthorst HJM, Verpoorte R: Халконсинтаза и ее функции в устойчивости растений. Phytochem Rev. 2011, 10: 397-412. 10.1007/s11101-011-9211-7.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Saavedra L, Svensson J, Carballo V, Izmendi D, Welin B, Vidal S: Ген дегидрина в Physcomitrella patens необходим для устойчивости к солевому и осмотическому стрессу.Завод Дж. 2006, 45: 237-249. 10.1111/j. 1365-313X.2005.02603.x.

    ПабМед КАС Статья Google ученый

  • Velasco-Conde T, Yakovlev I, Majada JP, Aranda I, Johnsen O: Дегидрины в приморской сосне ( Pinus pinaster ) и их экспрессия, связанная с реакцией на засуху. Генетика деревьев и геномы. 2012, 8: 957-973. 10.1007/с11295-012-0476-9.

    Артикул Google ученый

  • Mathieu M, Lelu-Walter MA, Blervacq AS, David H, Hawkins S, Neutelings G: Зародышевые гены экспрессируются во время соматического эмбриогенеза и раннего развития хвойных.Завод Мол Биол. 2006, 61: 615-627. 10.1007/s11103-006-0036-5.

    ПабМед КАС Статья Google ученый

  • Carrillo MGC, Goodwin PH, Leach JE, Leung H, Cruz CMV: Филогеномные связи оксалатоксидаз риса с надсемейством купина и их связь с QTL устойчивости к болезням. Рис. 2009, 2: 67-79. 10.1007/s12284-009-9024-0.

    Артикул Google ученый

  • Faini M, Prinz S, Beck R, Schorb M, Riches JD, Bacia K, Brugger B, Wieland FT, Briggs JAG: Структуры везикул, покрытых COPI, показывают альтернативные конформации коатомеров и взаимодействия.Наука. 2012, 336: 1451-1454. 10.1126/научн.1221443.

    ПабМед КАС Статья Google ученый

  • Pucadyil TJ, Schmid SL: Консервативные фрагменты мембраноактивных ГТФаз в образовании пузырьков с покрытием. Наука. 2009, 325: 1217-1220. 10.1126/науч.1171004.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Wegrzyn J, Lin B, Zieve J, Dougherty W, Martinez-García P, Koriabine M, Holtz-Morris A, de Jong P, Crepeau M, Langley C, Puiu D, Salzberg S, Neale D, Stevens K : Взгляд на геном сосны лоблоловой: характеристика последовательностей BAC и fosmid. ПЛОС ОДИН. 2013, 8: e72439-10.1371/journal.pone.0072439.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Камм А., Дудрик Р.Л., ХеслопХаррисон Дж.С., Шмидт Т.: Геномная и физическая организация последовательностей, подобных Ty1-copia, как компонента больших геномов у Pinus elliottii var elliottii и других голосеменных растений. Proc Natl Acad Sci U S A. 1996, 93: 2708-2713. 10.1073/пнас.93.7.2708.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Kossack DS, Kinlaw CS: IFG, цыганский ретротранспозон в Pinus (Pinaceae), имеет обширную историю в соснах. Завод Мол Биол. 1999, 39: 417-426. 10.1023/А:1006115732620.

    ПабМед КАС Статья Google ученый

  • Richards EJ, Ausubel FM: Выделение теломер высших эукариот из Arabidopsis thaliana . Клетка. 1988, 53: 127-136. 10.1016/0092-8674(88)

  • -1.

    ПабМед КАС Статья Google ученый

  • Лейтч А.Р., Лейтч И.Дж.: Экологические и генетические факторы, связанные с контрастной динамикой генома у семенных растений. Новый Фитол. 2012, 194: 629-646. 10.1111/j.1469-8137.2012.04105.х.

    ПабМед КАС Статья Google ученый

  • Aronen T, Ryyynanen L: Изменение теломерных повторов сосны обыкновенной ( Pinus sylvestris L.). Генетика деревьев и геномы. 2012, 8: 267-275. 10.1007/с11295-011-0438-7.

    Артикул Google ученый

  • Фланари Б.Е., Клетечка Г.: Анализ длины теломер и активности теломеразы у древесных пород различной продолжительности жизни и с возрастом у сосны щетинистой Pinus longaeva . Биогеронтология. 2005, 6: 101-111. 10.1007/s10522-005-3484-4.

    ПабМед КАС Статья Google ученый

  • Луо Р., Лю Б., Се И., Ли З., Хуан В., Юань Дж., Хе Г., Чен И., Пан Ц., Лю И., Тан Дж., У Г., Чжан Х., Ши И., Лю И., Ю. C, Wang B, Lu Y, Han C, Cheung D, Yiu SM, Peng S, Xiaoqian Z, Liu G, Liao X, Li Y, Yang H, Wang J, Lam TW, Wang J: SOAPdenovo2: эмпирически улучшенная память -эффективный ассемблер de novo с коротким чтением.ГигаНаука. 2012, 1: 18-10.1186/2047-217Х-1-18.

    ПабМед ПабМед Центральный Статья Google ученый

  • Паркс М., Кронн Р., Листон А.: Повышение филогенетического разрешения на низких таксономических уровнях с использованием массового параллельного секвенирования геномов хлоропластов. БМС Биол. 2009, 7: 84-10.1186/1741-7007-7-84.

    ПабМед ПабМед Центральный Статья Google ученый

  • Flor HH: Наследование патогенности в Melampsora lini . Фитопатология. 1942, 32: 653-669.

    Google ученый

  • Флор HH: Текущее состояние концепции «ген за геном». Анну Рев Фитопат. 1971, 9: 275-296. 10.1146/annurev.py.09.0.001423.

    Артикул Google ученый

  • Griggs MM, Walkinshaw CH: Диаллельный анализ генетической устойчивости к Cronartium quercuum f. сп. веретенообразный из сосны. Фитопатология. 1982, 72: 816-818. 10.1094/Фито-72-816.

    Артикул Google ученый

  • Wilcox PL, Amerson HV, Kuhlman EG, Liu BH, OMalley DM, Sederoff RR: Обнаружение основного гена устойчивости к болезни веретенообразной ржавчины у лоблоллийной сосны путем геномного картирования. Proc Natl Acad Sci U S A. 1996, 93: 3859-3864. 10.1073/пнас.93.9.3859.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Amerson HV, Nelson CD, Kubisiak TL: Обнаружение и картирование гена R при веретенообразной ржавчине.Леса. 2013 г., в обзоре

    Google ученый

  • Кесада Т., Резенде М.Ф.Р.Дж., Муньос П., Вегжин Дж.Л., Нил Д.Б., Кирст М., Питер Г.Ф., Гезан С. А., Нельсон К.Д., Дэвис Дж.М.: Картирование генов устойчивости к веретенообразной ржавчине в сложной конструкции спаривания лоблоллийной сосны. Леса. 2013, 5: 347-362.

    Артикул Google ученый

  • Kinloch BB, Parks GK, Fowler CW: пузырчатая ржавчина на белой сосне.Просто унаследовала устойчивость в сахарной сосне. Наука. 1970, 167: 193-195. 10.1126/науки.167.3915.193.

    ПабМед Статья Google ученый

  • Jermstad KD, Eckert AJ, Wegrzyn JL, Delfino-Mix A, Davis DA, Burton DC, Neale DB: Сравнительное картирование в Pinus : сахарная сосна ( Pinus lambertiana Dougl.) таеда л.). Генетика деревьев и геномы. 2011, 7: 457-468. 10.1007/s11295-010-0347-1.

    Артикул Google ученый

  • Кайихан Г.К., Хубер Д.А., Морс А.М., Уайт Т.Л., Дэвис Дж. М.: Генетическое исследование признаков веретенообразной ржавчины и смоляного рака у сосны лоблолли. Теория Appl Genet. 2005, 110: 948-958. 10.1007/s00122-004-1915-2.

    ПабМед Статья Google ученый

  • Whitham S, Dineshkumar SP, Choi D, Hehl R, Corr C, Baker B: Продукт гена устойчивости к вирусу табачной мозаики N: Сходство с toll и рецептором интерлейкина-1.Клетка. 1994, 78: 1101-1115. 10.1016/0092-8674(94)

    -6.

    ПабМед КАС Статья Google ученый

  • Meyers BC, Morgante M, Michelmore RW: белки TIR-X и TIR-NBS: два новых семейства, связанных с устойчивостью к болезням белков TIR-NBS-LRR, закодированных в Arabidopsis и других геномах растений. Плант Дж. 2002, 32: 77-92. 10.1046/j.1365-313X.2002.01404.x.

    ПабМед КАС Статья Google ученый

  • Кубисяк Т.Л., Андерсон К.Л., Амерсон Х.В., Смит Дж.А., Дэвис Дж.М., Нельсон К.Д.: Геномная карта, обогащенная маркерами, связанными с Avr1 в Cronartium quercuum f.sp. веретенообразный . Генетика грибов Биол. 2011, 48: 266-274. 10.1016/j.fgb.2010.09.008.

    ПабМед КАС Статья Google ученый

  • Маккинд С., Маллин Т., Байрам Т., Уайт Т.: Использование генетически улучшенных лоблолли и подпиленных сосен на юге.J Для. 2003, 101: 32-37.

    Google ученый

  • Джермстад К. Д., Шеппард Л.А., Кинлох Б.Б., Дельфино-Микс А., Эрсоз Э.С., Крутовский К.В., Нил Д.Б.: Выделение полноразмерного кандидата-аналога гена устойчивости CC–NBS–LRR из сахарной сосны, демонстрирующего низкое разнообразие нуклеотидов. Генетика деревьев и геномы. 2006, 2: 76-85. 10.1007/s11295-005-0029-6.

    Артикул Google ученый

  • Уилльярд А., Сайринг Дж., Гернандт Д.С., Листон А., Кронн Р.: Калибровка молекулярных расхождений по ископаемым указывает на умеренную скорость мутаций и недавнее излучение для Pinus .Мол Биол Эвол. 2007, 24: 90-101.

    ПабМед Статья Google ученый

  • Burns RM, Honkala BH: Silvics Северной Америки. Справочник по сельскому хозяйству 654. 1990, Вашингтон, округ Колумбия: США: Министерство сельского хозяйства, Лесная служба, 877-2

    . Google ученый

  • Brix H: Определение жизнеспособности сеянцев сосны обыкновенной после увядания. Бот Газ. 1960, 121: 220-223. 10.1086/336073.

    Артикул Google ученый

  • Ferrell WK, Woodard ES: Влияние происхождения семян на засухоустойчивость дугласовой пихты ( Pseudotsuga menziesii ) (Mirb) Franco.Экология. 1966, 47: 499-10.2307/1932994.

    Артикул Google ученый

  • Хаманиши ET, Кэмпбелл М.М. Реакция лесных деревьев на засуху в масштабах всего генома. Лесное хозяйство. 2011, 84: 273-283. 10.1093/лесное хозяйство/cpr012.

    Артикул Google ученый

  • Ньютон Р., Падманабхан В., Лупстра С., Диас М.: Молекулярная реакция древесных растений на дефицит воды. Справочник по стрессу растений и сельскохозяйственных культур.1999, Бока-Ратон, Флорида: М. Пессаракль, CRC Press, 641-657.

    Google ученый

  • Ньютон Р.Дж., Фанхаузер Э.А., Фонг Ф., Тауэр К.Г.: Молекулярно-физиологическая генетика засухоустойчивости лесных видов. Для Экол Менеджмент. 1991, 43: 225-250. 10.1016/0378-1127(91)

    -Ж.

    Артикул Google ученый

  • Chang SJ, Puryear JD, Dias MADL, Funkhauser EA, Newton RJ, Cairney J: Экспрессия генов при дефиците воды в сосне лоблолли ( Pinus taeda ): выделение и характеристика клонов кДНК.Завод Физиол. 1996, 97: 139-148. 10.1111/j. 1399-3054.1996.tb00490.x.

    КАС Статья Google ученый

  • Франкель Н., Каррари Ф., Хассон Э., Юсем Н.Д.: Эволюционная история семейства генов Asr . Ген. 2006, 378: 74-83.

    ПабМед КАС Статья Google ученый

  • Юсем Н.Д., Варфоломей Д.М., Хитц В.Д., Скольник П.А.: Томатный ( Lycopersicon esculentum ) транскрипция, индуцированная дефицитом воды и созреванием.Завод Физиол. 1993, 102: 1353-1354. 10.1104/стр.102.4.1353.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Cortes AJ, Chavarro MC, Madrinan S, This D, Blair MW: Молекулярная экология и селекция связанных с засухой полиморфизмов гена Asr в дикой и культивируемой фасоли обыкновенной ( Phaseolus vulgaris L.). БМС Генет. 2012, 13: 58-

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Shen G, Pang YZ, Wu WS, Deng ZX, Liu XF, Lin J, Zhao LX, Sun XF, Tang KX: Молекулярное клонирование, характеристика и экспрессия нового гена Asr из Ginkgo biloba . Завод Физиол Биохим. 2005, 43: 836-843. 10.1016/j.plaphy.2005.06.010.

    ПабМед КАС Статья Google ученый

  • Лоренц В.В., Альба Р., Ю.С., Бордо Дж.М., Симоэс М., Дин Д.Ф.Д.: Анализ микрочипов и генные сети без чешуи идентифицируют регуляторы-кандидаты в корнях сосны лоблолли, подверженной засухе ( P.таеда л.). Геномика BMC. 2011, 12: 264-10.1186/1471-2164-12-264.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Гонсалес-Мартинес С.К., Уилер Н.К., Эрсоз Э., Нельсон К.Д., Нил Д.Б.: Ассоциативная генетика в Pinus taeda LI. Признаки свойств древесины. Генетика. 2007, 175: 399-409.

    ПабМед ПабМед Центральный Статья Google ученый

  • Пайва Дж.А.П., Гарсес М., Алвес А., Гарнье-Гер П., Родригес Дж.К., Лаланн С., Поркон С., Ле Провост Г., Перес Д.Д., Брач ​​Дж., Фриджерио Дж.М., Клаверол С., Барре А., Феверейро П., Пломион C: Молекулярное и фенотипическое профилирование от основания до кроны в деревообразующей ткани приморской сосны.Новый Фитол. 2008, 178: 283-301. 10.1111/j.1469-8137.2008.02379.х.

    ПабМед КАС Статья Google ученый

  • Joosen RVL, Lammers M, Balk PA, Bronnum P, Konings MCJM, Perks M, Stattin E, Van Wordragen MF, van der Geest AHM: Корреляция экспрессии генов с физиологическими параметрами и условиями окружающей среды во время холодовой акклиматизации Pinus sylvestris, идентификация молекулярных маркеров с использованием микрочипов кДНК. Физиол дерева.2006, 26: 1297-1313. 10.1093/treephys/26.10.1297.

    ПабМед КАС Статья Google ученый

  • Eveno E, Collada C, Guevara MA, Leger V, Soto A, Diaz L, Leger P, Gonzalez-Martinez SC, Cervera MT, Plomion C, Garnier-Gere PH: Контрастные модели отбора в Pinus pinaster Айт. Гены-кандидаты стресса от засухи, выявленные анализом генетической дифференциации. Мол Биол Эвол. 2008, 25: 417-437. 10.1093/молбев/msm272.

    ПабМед КАС Статья Google ученый

  • Гривет Д., Себастьяни Ф., Гонсалес-Мартинес С.К., Вендрамин Г.Г.: Модели полиморфизма, возникающие в результате дальней колонизации средиземноморской хвойной сосны Алеппо. Новый Фитол. 2009, 184: 1016-1028. 10.1111/j.1469-8137.2009.03015.х.

    ПабМед КАС Статья Google ученый

  • Дональдсон Л.А. Лигнификация и топохимия лигнина – ультраструктурный взгляд.Фитохимия. 2001, 57: 859-873. 10.1016/S0031-9422(01)00049-8.

    ПабМед КАС Статья Google ученый

  • Sperry JS, Hacke UG, Pittermann J: Размер и функция трахеид хвойных и сосудов покрытосеменных. Эм Джей Бот. 2006, 93: 1490-1500. 10.3732/ajb.93.10.1490.

    ПабМед Статья Google ученый

  • Weng JK, Akiyama T, Bonawitz ND, Li X, Ralph J, Chapple C: Конвергентная эволюция биосинтеза сирингиллигнина различными путями у ликофитов Selaginella и цветковых растений. Растительная клетка. 2010, 22: 1033-1045. 10.1105/тпк.109.073528.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Шеллер Х.В., Ульвсков П.: Гемицеллюлозы.Annu Rev Plant Biol. 2010, 61: 263-289. 10.1146/annurev-arplant-042809-112315.

    ПабМед КАС Статья Google ученый

  • Shi R, Sun YH, Li QZ, Heber S, Sederoff R, Chiang VL: К системному подходу к биосинтезу лигнина в Populus trichocarpa : обилие транскриптов и специфичность генов биосинтеза монолигнола. Физиология клеток растений. 2010, 51: 144-163. 10.1093/pcp/pcp175.

    ПабМед КАС Статья Google ученый

  • Osakabe K, Tsao CC, Li LG, Popko JL, Umezawa T, Carraway DT, Smeltzer RH, Joshi CP, Chiang VL: Кониферилальдегид 5-гидроксилирование и метилирование прямого биосинтеза сирингиллигнина в покрытосеменных.Proc Natl Acad Sci U S A. 1999, 96: 8955-8960. 10.1073/пнас.96.16.8955.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Ванхолм Р., Чезарино И., Ратадж К., Сяо Ю.Г., Сундин Л., Гоэмин Г., Ким Х., Кросс Дж., Моррил К., Араужо П., Уэлш Л., Хаустрате Дж., Макклеллан С., Ванхолм Б., Ральф Дж., Симпсон GG, Halpin C, Boerjan W: Caffeoyl shikimate esterase (CSE) представляет собой фермент в пути биосинтеза лигнина в Arabidopsis .Наука. 2013, 341: 1103-1106. 10.1126/научн.1241602.

    ПабМед КАС Статья Google ученый

  • Thumma BR, Nolan MR, Evans R, Moran GF: полиморфизмы циннамоил-КоА-редуктазы (CCR) связаны с изменением угла микрофибрилл у Eucalyptus spp. Генетика. 2005, 171: 1257-1265. 10.1534/генетика.105.042028.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Yu Q, Li B, Nelson CD, McKeand SE, Batista VB, Mullin TJ: Ассоциация аллеля cad-n1 с усиленным ростом ствола и плотностью древесины в однородных семействах сосны лоблолли. Генетика деревьев и геномы. 2006, 2: 98-108. 10.1007/с11295-005-0032-у.

    Артикул Google ученый

  • Демура Т., Фукуда Х. Регуляция транскрипции при формировании древесины. Тенденции Растениевод. 2007, 12: 64-70.

    ПабМед КАС Статья Google ученый

  • Melzer S, Lens F, Gennen J, Vanneste S, Rohde A, Beeckman T: Гены времени цветения модулируют детерминированность меристемы и форму роста у Arabidopsis thaliana .Нат Жене. 2008, 40: 1489-1492. 10.1038/нг.253.

    ПабМед КАС Статья Google ученый

  • Fraser CM, Eisen JA, Nelson KE, Paulsen IT, Salzberg SL: Значение полного секвенирования микробного генома (вы получаете то, за что платите). J Бактериол. 2002, 184: 6403-6405. 10.1128/JB.184.23.6403-6405.2002.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • ван Донген С., Абреу-Гуджер К.: Использование MCL для извлечения кластеров из сетей. Бактериальные молекулярные сети. 2012, 804: 281-295. 10.1007/978-1-61779-361-5_15.

    КАС Статья Google ученый

  • RepeatMasker. [http://www.repeatmasker.org/]

  • Flutre T, Duprat E, Feuillet C, Quesneville H: Рассмотрение разнообразия мобильных элементов в подходах к аннотации de novo .ПЛОС ОДИН. 2011, 6: e16526-10.1371/journal.pone.0016526.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Benson G: Поиск тандемных повторов: программа для анализа последовательностей ДНК. Нуклеиновые Кислоты Res. 1999, 27: 573-580. 10.1093/нар/27.2.573.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Эталонные последовательности сосны.[http://www.pinegenome.org/pinerefseq]

  • Lee E, Helt GA, Reese JT, Munoz-Torres MC, Childers CP, Buels RM, Stein L, Holmes IH, Elsik CG, Lewis SE: Web Apollo: веб-платформа для редактирования геномных аннотаций. Геном биол. 2013, 14: R93-10.1186/gb-2013-14-8-r93.

    ПабМед ПабМед Центральный Статья Google ученый

  • Stein LD, Mungall C, Shu SQ, Caudy M, Mangone M, Day A, Nickerson E, Stajich JE, Harris TW, Arva A, Lewis S: Общий браузер генома: строительный блок для модельной системы организма база данных.Геном Res. 2002, 12: 1599-1610. 10.1101/гр.403602.

    ПабМед КАС ПабМед Центральный Статья Google ученый

  • Описание буквенно-цифрового сообщения GFS MOS MAV
        

    Описание буквенно-цифрового сообщения GFS MOS MAV


    Руководство MOS MAV ближнего действия на основе GFS создается на основе выходных данных модели 00:00, 06:00, 12:00 и 18:00 UTC из Глобальной системы прогнозирования (GFS) NCEP.Это руководство действительно для станций в США, Пуэрто-Рико и на Виргинских островах США. Для самый последний список станций нажмите здесь. Элементы прогноза действительны от 6 до 72 часов.



    Образец сообщения

    РУКОВОДСТВО KDEN GFS MOS 04.03.2010 12:00 UTC
    DT /4 марта/5 марта /6 марта /7 марта
    ЧСС 18 21 00 03 06 09 12 15 18 21 00 03 06 09 12 15 18 21 00 06 12
    Н/Х 27 53 28 51 24
    ТМП 48 52 51 40 35 32 30 35 47 50 48 40 38 35 32 36 45 48 45 31 27
    ДПТ 25 25 27 29 29 27 25 25 21 17 18 20 21 21 20 21 21 22 22 23 21
    CLD BK SC SC SC SC OV OV OV BK BK BK SC BK SC SC SC SC SC SC SC SC
    Широкий динамический диапазон 19 14 13 16 20 20 25 25 28 28 28 22 23 23 22 21 12 10 10 17 21
    ПОБ 05 12 11 08 08 07 07 07 08 10 11 08 08 07 07 07 07 10 10 08 07
    P06 1 6 14 20 14 25 8 4 2 3 2
    Р12 15 27 26 4 3
    Q06 0 0 0 0 0 0 0 0 0 0 0
    Q12 0 0 0 0 0
    T06 5/11 1/ 2 0/ 1 1/ 2 8/ 3 1/ 1 0/ 0 0/ 0 2/ 8 0/ 0
    Т12 7/11 1/ 2 8/ 4 0/ 1 2/ 8
    ПОЗ 1 1 3 2 2 7 8 3 4 2 3 0 3 3 4 6 3 1 2 0 3
    POS 27 16 18 24 28 65 74 72 31 20 37 57 94 87 95 65 41 18 28 50 91
    ТИП Р Р Р Р Р С С С Р Р С С С С С Р Р Р С
    СЗ 0 0 0
    CIG 8 8 8 8 8 8 8 7 8 8 7 8 8 8 8 8 8 8 8 8 8
    ВИС 7 7 7 7 7 7 7 1 7 7 7 7 7 7 7 7 7 7 7 7 7
    OBV N N N N N N N N N N N N N N N N N N N N N
     
    • DT = День месяца, обозначаемый стандартной трех- или четырехбуквенной аббревиатурой.
    • HR = Час дня по времени UTC.Это час, когда прогноз действителен, или, если прогноз действителен в течение периода, конец периода прогноза.
    • N/X = минимальная ночная/максимальная дневная температура поверхности.
    • TMP = температура поверхности, действующая в этот час.
    • DPT = точка росы на поверхности, действующая в этот час.
    • CLD = категории прогноза общего небесного покрова, действительные в этот час.
    • WDR = прогноз направления ветра на расстоянии 10 м в час, выраженный в десятках градусов.
    • WSP = прогноз скорости ветра на высоте 10 м в час в узлах.
    • P06 = вероятность осадков (PoP) в течение 6-часового периода, заканчивающегося в это время.
    • P12 = PoP в течение 12-часового периода, заканчивающегося в это время.
    • Q06 = категория количественного прогноза осадков (QPF) для количества осадков в жидком эквиваленте за 6-часовой период, заканчивающийся в это время.
    • Q12 = категория QPF для количества осадков в жидком эквиваленте за 12-часовой период, заканчивающийся указанное время.
    • SNW = категориальные прогнозы снегопадов в течение 24-часового периода, заканчивающегося в указанное время.
    • T06 = вероятность грозы/условная вероятность сильной грозы в течение 6-часового периода, заканчивающегося в указанное время.
    • T12 = вероятность грозы/условная вероятность сильной грозы в течение 12-часового периода, заканчивающегося в указанное время.
    • POZ = условная вероятность зависания ПКП в час.
    • POS = условная вероятность выпадения снега в течение часа.
    • TYP = тип условных осадков в час.
    • CIG = категориальные прогнозы высоты потолка в час.
    • VIS = видимость категориальные прогнозы на час.
    • ОБВ = препятствие для видения категориальных прогнозов на час.

    Определения категориальных элементов

    9098 9098 9
    MAV Высота потона 9098 9
    2 200 — 400 футов
    3 500 — 900 футов
    4 1000 — 1900 футов
    5 5 2000 — 3000 футов
    6 3100 — 6500 футов
    7
    6600 — 12 000 футов
    8 > 12 000 футов или неограниченного потолка

    MAV Visibility (Vis) Категории

    1 & LT 1/2 мили
    2 1/2 — & LT 1 мили
    3 1 — & Lt 2 мили
    4 2 — < 3 миль
    5 3 — 5 миль
    6 6 6 миль
    7 & GT 6 миль
    MAV QPF Категории
    0
    1 0. 01 до 0,09 дюймов
    2 0,10 до 0,24 дюйма
    0,25 до 0,49 дюймов
    4 от 0,50 до 0,99 дюймов
    5 1,00 до 1,99 дюймов
    6 2,00 дюйма или больше
    MAV Cloud (CLD) Категории
    CL CL
    немногих> 0 до 2 OCTAS
    9098
    разбросаны> 2-4 октас
    BK Brada> 4-
    OV OV

    MAV Обструкция к Vision (OVE) Категории

    N Ни один из следующих
    HZ HZ HZ HZ , Дым, Пыль
    MR Туман (туман с видимостью> = 5/8 миль)
    FG Туман или фабричный туман (видимость
    BL дует пыль, песок, снег

    MAV Выпадение снега Категории сумм

    9 9
    0 Нет снега или следа, ожидаемый
    1 > след до
    2 до
    4 4 до
    6 6 до
    8 > = 8 дюймов

    MAV Тип осаждения (типы) Категории

    S Чистый снег или снежные зерна
    Z ледяной дождь/изморось, ледяная крупа или
    все, что смешано с ледяными осадками
    R чистый дождь/изморось или дождь со снегом
    2
    Последнее изменение страницы: Четверг, 04 марта 2010 г. , 18:25 UTC

    Расшифровка приговора ВС о правах дочерей

    Верховный суд постановил, что дочери, как и сыновья, имеют равное право по рождению на наследование совместной собственности, и сказал, что поправка 2005 года, внесенная в Закон о наследовании индусов 1956 года, будет иметь обратную силу. Ришаб Шрофф , партнер Сирил Амарчанд Мангалдас объясняет последствия приговора.

    Какая была поправка 2005 года?

    Поправка была принята в 2005 году, чтобы предоставить равный статус как сыновьям, так и дочерям совладельцев. До внесения поправки права совладельца предоставлялись только сыновьям совладельца.

    Кто такой сопартнер?

    Совладелец – это тот, кто приобретает права на имущество своего отца при рождении и может потребовать раздела совладельца в любое время.

    В чем была путаница и что теперь прояснилось?

    В то время как поправка стремилась предоставить равные права как сыновьям, так и дочерям, используемая формулировка оставляла место для различных пробелов, что привело к противоречивым взглядам Верховного суда по этому вопросу. До вынесения решения равный статус предоставлялся только тем дочерям, чей отец (совладелец) был жив, когда поправка вступила в силу 9 сентября 2005 г. В настоящее время решение разъясняет, что равные права, предоставляемые дочерям совладельцев, будут предоставлены в рождения, независимо от даты смерти отца.ВС пояснил, что поправка будет применяться ретроспективно, а не только в случаях, когда отец жив на дату внесения поправки.

    Каковы условия применимости приговора?

    Это применимо при условии, что совместное имущество не должно быть разделено отцом до 20 декабря 2004 г. До тех пор, пока имущество остается совместной собственностью и не было разделено на эту дату, дочь может теперь требуйте проценты в том же самом.

    Какие категории лиц относятся к индуистской неразделенной семье (HUF)?

    Один — coparcener, на которого только влияет вердикт. Вторая категория — это член (жена), который имеет право только на содержание и не получит никаких прав наследования или права добиваться раздела в совместной собственности.

    Что теперь делать дочерям?

    С дочерьми теперь будут обращаться наравне с сыновьями совладельцев, и им будут предоставлены равные совладельческие права на имущество отца при рождении.Даже их семейное положение не повлияет на права, предоставляемые ими в соответствии с поправкой — следовательно, они продолжают быть частью венгерских форинтов своего отца после брака, и они могут добиваться доли и могут завещать свою долю в венгерских форинтах по своему завещанию любому бенефициару. они выбирают.

    Как насчет влияния приговора на семейный бизнес и других лиц?

    Чтобы было ясно, это решение применяется только к имуществу в венгерских форинтах и ​​не затрагивает личные или самостоятельно приобретенные активы, находящиеся в индивидуальном владении.

    На самом деле большая часть личного имущества, включая право собственности на ценный семейный бизнес, хранится либо на личное имя патриарха/учредителя, либо в частных трастах или холдинговых компаниях/товариществах с ограниченной ответственностью (LLP).

    «Пожилые» бизнес-семьи могут продолжать владеть некоторым наследственным богатством в венгерских форинтах, но размер и материальность таких владений обычно ограничены. Почти ни одна бизнес-семья не создает новые HUF, и фактически большинство существующих HUF распускаются.

    [PDF] Обучение переворачиванию декодирования полярных кодов с последовательным аннулированием с помощью сетей LSTM предлагается улучшить алгоритм декодирования SC-Flip для низкоскоростных кодов, основанный на наблюдении распределений ошибок, вызванных каналом, включая схему выбора фиксированного индекса (FIS), чтобы избежать значительных затрат на реализацию выбора LLR и сортировки без затрат на производительность исправления ошибок.Expand

    • Посмотреть 1 отрывок, справочная информация

    Декодирование полярных кодов с помощью Dynamic-SCFlip

    Результаты моделирования показывают, что D-SCFlip является эффективной альтернативой декодированию полярных кодов с помощью списка SC, обеспечивая очень хорошие характеристики исправления ошибок с средняя вычислительная сложность близка к таковой у SC-декодера. Expand
    • Просмотреть 5 выдержек, справочных материалов и методов

    Масштабирование декодирования полярных кодов на основе глубокого обучения с помощью разбиения

    Эта работа разделяет граф кодирования на более мелкие подблоки и обучает их индивидуально, близко приближаясь к максимальному апостериорному (MAP) производительность на подблок, и показывает ухудшение из-за разделения и сравнивает полученный декодер с современными полярными декодерами, такими как последовательный список отмены и декодирование распространения доверия.Expand

    Списочное декодирование полярных кодов

    Представляется, что предложенный списочный декодер устраняет разрыв между последовательным аннулированием и декодированием полярных кодов с максимальным правдоподобием и разрабатывает эффективную, численно стабильную реализацию, требующую только O(L · n log n) времени и O( L · n) пространства. Expand
    • Посмотреть 2 выдержки, справочная информация

    Улучшенное декодирование полярных кодов с последовательным аннулированием

    Унифицированные описания алгоритмов декодирования SC, SCL и SCS представлены в виде процедур поиска пути в кодовом дереве полярных кодов и нового алгоритма декодирования называется гибридом с последовательным аннулированием (SCH), чтобы обеспечить гибкую конфигурацию, когда сложности во времени и пространстве ограничены.
  • Опубликовано в категории: Разное

    Добавить комментарий

    Ваш адрес email не будет опубликован.